Transcript

il6st-202

ID
ZDB-TSCRIPT-090929-17656
Name
il6st-202
Previous Names
  • il6st-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000037230 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037230|OTTDARG00000027608|ZDB-GENE-080104-6 il6st|OTTDARP00000029835 il6st-001 LG_none BX294128.19,BX321872.10 Danio rerio protein_coding KNOWN, 8300 bp
GGCGAACAGACATAACTTCATCATTCGCGATGTCTTCAAA
TTTACAGTAATAATATGATTACACAAAGACACCAGGCTTG
ATGTGACCATGGACACTTCACATCATTGGCTGTTGGTCTT
GATGCTCTTGCATTATGCAAAAGGTTCCAACAGTAGCTGT
GTATTAAAAATTCTTCCAGACTCCAAGACTAAGATTCCTG
TTGAGTTGGAAAGAAACTTCACAGCGACATGCCACCTCCA
GGGTGGATCTGAATTTACCTCAAATGACATCAAATGGTCT
TTTAGCAACAAAGAAACTACAGACATTTTATCAAAGACAT
TTTATCACAAAATAAATGAAACCTCCGTCAGTGTTACAGT
TAACCTCAGCAAAAACATGGGTCATATGTTGATGTGTGAA
GCCTCCAGAGAGTCCTTAACATACATGGGAAAATGTGCCT
ACGGAATCTACCTTGATGCAGGATACCCTCCGATGAAACC
AAAGAATCTGACATGCATTGCTTTGCAAAGGAAGAAGGAT
ATTTCTCCTGACCTAAATTGTTATTGGGAACCAGGATTGA
GAGACCCACTGCTTGCCACCAATTATACTCTTTATGCCCA
AGTAGGACAAGATTTATATAACAGCACCTGTAAACAGAGT
CTTGCAAGAAGTTGCACCGTCAACCTGAGCACTTATCCTG
TTCATATGACTTTGAAAGTCTGGGTTGAAGTGAAAAATTC
ACTGGGGTCAGAACGGTCAGACGAACACGAGTACGATTCC
TTGAGTCTTGTGAAACCAAATCCACCAAATGTCGAAGTTA
AAGTTGAAGAGGACTTCCCTACATCTTTTGTGGTTAAATG
GGAGTATGACATTGAAGACACAACTATGCGATTCTCCAGT
GCCATTAGATACTGCCAAGTAGGGTCAAGTGATTGGAAAA
AGGTGCCTGAGAACTACACCAATGTGCACATTACGTCGTA
TCGACTGCAGTCCCTAGAGCCTTACACTGAGTATGTGGTA
CAGATGCGATCCATCGGAGAGCACTACACCATCTGGAGTG
AATGGAGCTCCAATGTTACAGTTCGCACTCCAGAAGCCAA
GCCAGCAAGTCCACCAGACCTGTGGAGAATCATCCAGCAC
ACGCCTGGGAAAAGAAACGTCACATTAATGTGGAAGCCTC
CTGTGAAAGCTAATGGAAAAATGTGTAACTATTCCCTGAT
CATCAGTCAAGATAACCAGGCTTTTGAAAGTCACGTTATA
AAAGCTGATCAGCTCAACCAGAGGTATTCACTGGAAGTGC
CACCAGAAGAAAATGCCAGTATTGAAATAACTGCATTCAA
TTCAGCCGGAGGGTCTCCCAAAACTATTTTGTTCATTCCA
AGATCAAATGACGAGTTTCTTGGCGTGGCGAGCATGAGGT
GGTGGGTTCATGATGGAAAGCTTCATGTGGAATGGGGTCC
TTTGAAGCAGCATCCTCCTCATGGCATTCATATCTCAGAA
TATCTGCTGGAGTGGGTGAATGAAAAAGATGTTCAGCCTC
AGTGGCAGAGGGTTCCTAAAAATGTCAACACCACCATACT
GAACGGTAATTTAGCCAAATACAAGCAGTACAACATATCA
GTCTATCCAATCTACAAGTTCTATTATGATGGTCGATGGC
ATTTCCAAGCAGGAACACCAGTAACCAAGCCAGCCTACGT
TCAGCAAGGAGCACCAGAGAAAGGCCCTACTGTCACAGAT
ACCATTTCCAAGAAAAATAGTGTTACACTGATATGGGAGG
AAATTCCACTGGACCACCGGTATGGATTCATCCAAAACTA
CACCATATTCTACAGGACCGGCAACGCTGAGTGGCAATCT
GTGCTAGTGGCCGCTAACATCCACTCGTATGTATTGACTG
ATCTGGTCAGTGAACGCGACTATGTGGTTCACATCATGGC
CTCGACGGAAGCTGGCTCCAAAAACGGCACCGATTTTAAT
TTCAAAACAATGAAGTTCGCCGATGGAGAGGTGGAGATGA
TTGTAGTGCTGGTGTGCCTCGGCTTCCTGTTCCTGAGCGT
CTTCACCATAATGCTCTGCCTTCGCAAGAGAGAAGTGATT
AAGAAGCTGTTATGGCCGCAAGTCCCGGATCCGTCTGACA
GCTCTATTGCCCACTGGTCACCTGATTTCCCTGTAAAGAC
CGAAATGCCCAAGGAAGACGTCAGCGTGGTGGAAGTGGAC
GTGTTTGACGGCAAGTCTTTGTGCGAAGAAGATAAAGTTG
TTCTGCCGCTAAAGAAGGACAAGTACCTCTCCGAGGAGCA
CAGCAGCGGTATTGGAGGCTCGTCCTGCATGTCTTCGCCC
CGCCACAGTGTTTCCGACAGCGATGAGGGCGACTCGGGCC
AGACCACGGCCAGCACCGTCCAGTACTCGTCAGTGGTGGC
CAGCGGATACAAGGGCCAAACCCCAAACCATCAGCCTCCA
ACGTTCGCCCGCTCCGAGTCCACACAACCGCTGCTGGACT
GCGAGGAGCATCCAGAGAATCATCCCGGCGAGAGGAACTC
TTACTTTAGACGGGGCCGAGAGCTGGAGCCGCAGAGTATC
GATGAGCCTGTTTTCAGCGCGGTGCAGGAGGAAGAAGCAT
CTCCCGTTGTGGATGATGCGCCGGCGTTAAGTTACATGCC
GCAGCAGAGCGGGTATCGACCGCAGTAAAGCAGAACTTTT
CCGTAAGCTGTATAGAGCCACATTTTCACAGGGCACCTTT
AAGTGCCTGGCATGAACTTTTTAGGTTGCGTTTTAATTGG
ATTGCAGGCTTATGCTAGACATGTATAGTAACACTAGATT
GCATCCTTAAAAAGTAAATATCCGTTTAAAAAACGAAACA
AAACAGTGAAGCTGTCTACGGTTTGATATCGCACTCACAC
TGCCACGTGCCTTTACTGGACGATCAGCCATTGCTGTTTA
TAACTGGCAATTAAAGCCACTTCCTTAAAGGGGCAGTTTA
CCCAAAAATGAAAATTCTCTGGTTGTTCCAAACTTTTTTG
AGTTTGAATGTTGAAAAGCATGAGCCTATTGAGGTCCGTA
GTATTGTTTTTATTGCTACTATAGATAGCGTTGGCTACCA
TTTGATGATTGTTTGGTGTTCAACAGAAAAAAAGAAATTT
GTGAAAAAGTTTAGAACCACTTGAGTTGAGGAAATGGTGA
GGAAATGTTCACTTTTGGGTGAACTGCCCCTTTAAAATGT
TACTGTTGTTTTGAATCTTGTGTACTTTGTATAAGGACCC
TTGAAATACGTTTTTTTTAGTTACCTAAACTCAAATATTT
TAAAAAATTTTGTTTTATTTTATTGATTAATCGTGAAAAT
CAAGTGATTACAATTAAGAAAAAGATTGTCCAGCAGAGAG
TGCAGAACTAATGCCAGAATAATTGCTGTTAGTGTTCTGA
TTGGTCAGTGCCTGAATATTCTTATTGGTCATATCTTGAA
TTTTCTGGTTGGTCAGAGCCTCAATGTTCTGATTGGTCAG
AGCTTGAATAATCTGATTGTTCAGTAGTTAGTTGGTTTTC
TGATTGGTCCATGTTTTGGTCAACGCTAATTGCTGTTAGT
GTTCTAATTGGTCAGTGCTCAGCCGATGTTCTGATTGGTC
AGTGCCAGAATATTCTGATTGGTCATTTCCTGAGTTTTCT
GATTAGTCACAGCCTGAATGTTCTGATTGGTCAGTGCCTA
GTCGTTGTTCTGATTGGTCAGAGCTTGAATAATCTGATTG
TTCAGTAGTTAGACAGTTTTCTGATTGGTCAGTGCTAATT
GCTGTTAGTGTTCTAATTGGTCAGAGCCTGAAAATTCGGA
TTGGTCAGAGCCTGAATTTTTTGATTGGTCAGTCTGAAAT
TTCAGATTGGTCAGAGTCTGAATCTTCTGATTAGTCAGAG
CCTCAATGTTCTGATTGGTCAGTGCTTAGCTGGAGTTCTG
ATTGGACAGTGACTGAATTTTTTAATTTGTCAATGGCAGA
ACGTTCTAGTTGGTCAGTGTTTATGTAGTATTTTGAGTTT
GTTCAGATTTCTTTATTTTTTTAATTATGTGAGGTTTCAA
TTTCAAATTTCTGAGGGAAGTTACATCTGTGGTTAAAAAT
AAAATTTGACGATAACAATTTGAACATTTTGCTCTACTAT
GGAAATTAGACCAAGTCAAATATTTTATGGAACATAACTG
TGTGTTCACACTAAAGACGTTGAGAGCATCAAAGTTCAAT
CTGGCCGCCCTGAAGACAACGCTGTCTGCCTTTACTGCTC
TGCTGGCGAAAGCGTCAAAATTCTCTACATTGATTTTGTA
TTTAAAGGGGCTGTTGCAGCATATTAGCAAATCACTTACA
TCCACACATAAAAACTTGCTTTCTAGCATGAAAATGTTGC
ACACTTTTTTTCAAATTCAGTTAACTTTGGAAGATCAAGA
TGGTGCATGTGCTGTGGCTTTGCTCCACTTAACCAATATG
TCCATTTATCTGAAATATTCTGAAGCAGCAACAGGGGCGG
ACTGGCCATCTGGCAATTCTGGCAAATGCCAGAAGGGCCG
GACCAATTTTTAAATGTGGGCCGGTCAGGTTTTTTTAAAA
TATGTATTGTTTTTAAGTGCAGACAGCTTTTAACTCTTGC
TAGATGTGATATTATGATGATGATAATAATAATAATAAAT
GTTAAGCATTTGGCCCAATCGGCAACTGCCGCCTGGTTTC
AAGATGGGCCGACCCAATCCGAGGTTACCCATACATAATC
AAAATCTGGCAAGAATGTCATATTATTTCACCATCTGTAG
ACTAAATAGTGAATGTGCGTGTCTGTGGGTGGGGCTGTTT
CGGTGTGGTAATGTGGGCTGGTGTGTCTACAGTGCCAGGG
CTGAATTTTTGTCCCAGTCCGCCCCTGAGCAGCAATACTG
TGGTGCGTTTCCCAAAACCATCGTTAGCCAACTAAGGTCG
CAAGTTCCTTCGTTACAAACATAGTTTGTTGATTTGCCAT
TTCCCAAATCCGTCGCTCCAACGAACATTCGCAAACTTGA
GGACTTCCAACTACAGCTTTGGAGCTGTAGTTAGAAACAT
AGTTCCTGGCTGTGTTCTATTCCCACTTATCCCCCCCATA
TGCCCTATTTAGAACATTCTAACATTCAATGTTGGAGTTA
TTAAAAATAAAAAAAGCATTAAGGTTATCTCCTTTAGGTG
TAATTTGCTTCCAAACTATTTTTACAGTTCAGTTTTAACG
ATCTTCACGTTTACAATTGTGCTCCCTTCGCAGTGCACTT
TGAAAACATTGATGTCATTTTAAACACAGCCTCGTGGCGA
AAGCTATAGATGACCTATTATTTAAAAGCAGAATTTGTTA
CGTCTCCAAAGCTTGTGAAAACAAAAAGCATACGTTAATT
CTTTTAATTTATTGTGGGTTTTTTATTACAATATCATTTG
GACAAATCAATTTAGGTTTTTCTCTAAAGAAGTAGTTACT
CCACCCAGTGTCATTATGGGGGTTTAACGTTATAACTAAC
ATGGTTCAAGCAATGGTTCTGCGACAGAGAAACTAGGGTT
TTGGGAAACACCCGTCACTACATCGTTCTTTTCCCAAACG
ATGCATCGTACTATGATAGTTCCGCCGCGAGTTACATTGT
TGTTTGGGAAACGCACCCCTGTTTAATACTGCCGTTATAG
TTAGTATGAGATTCCCTTCTTTTAAAAAAATGCATATATA
ATAGTCACATCAGCAGGCCAGTAACTGATACTGTAAAAAA
AACATTGTAAATAATCGGAAATTAGGCAATTGTGGCCAAA
ACTAAAGTTCTCTGAAATCCTCTCAAGCGGTGGACTTGAA
TATTACGATTTCGGCTTGCTGCCGAAATGCGTCATAACTC
ACTACCATAAAGTCAACTTTATTTCAACTCTCCTCGACTC
CCACATCGCTAAAGACGCACTGCTCCTCTCCGGTTATCAC
CGCCCGCTTCCATTGAAAATGAATGACTTCCGGCTACTTT
GACGCTCTCGTCGCCTTCTGCCTGAACGCATGTAACTGGA
TAGGAGTGTTTTGGGAGTGTGTCCGCGCAGTTGATCTTGT
AGAGCATGTTAATTTTTAACAGCCTTATTTTACTCATCAA
TTGAAGATTCCAATTTAAGAAACAATGCCGTGAGTTATTG
TTCTGGGTTCTGATGTCATTCTTGCACCACTATATCTGAA
ATCACACCATTTGTTTTGCTGTAGAAGCTTGATAAGAGTT
TATCAAGAATTGACCAATGAAACCTGCTTTATTCAGTCTC
AAATATTGATTGTATTCCTGTTAAACGGGAAAACATTGGA
GGGTAATTGTGTGATTATTTGTGAAATGTAACATTCTTAT
TGTACTTGTTGTTTCACTGCGAAGTACATTCAGACGTATA
ATAGTGATACATTTCTGTTACGATTTCAAGTTAAGCCAAA
GTGTTGAGGAATCGTCATGCGGATGATTGAGTTTCCGCAT
ATAGATGACAGATCTTCTCTTATCCGCTTGTTAAGTGTGA
CGTCACGCGAAGCGGCTTCCGGGTCCAGGCGCTCTATTCA
ACTGAATGGGGAGACTCATGAAATGGTAATAATAAACGTT
TACAAAGCGATTAAATACTTTCGAAAATCACGATCGCAAT
ATATATGTCCATGCCTAATATCCAAAGGCCAGAAAGTGAT
ACATTTTTTATAAATTGTTAAATTTTTGGTATTTGTGATG
CAGCAAGCCCAGAGATTGTCGTGTACACTGTGATTTTATT
TAAATTTAACTTTAATGTGTGATAGTAATAAAACGTGATC
ATAAACGAATGATTTCTCCACTCAAATGAATGGCGGCTTG
GACCCGGAAACAGTATTACATACGTCACCACTTAACAAGT
GGATTAAACCAGTAAATGCTGCTGGAGTGTGTGTCAGAGC
AGCTCTGGAGATCATCGGCAGATCCTAAATGTTCTGATGG
GTTGGTAGTTGAATGTTCTGATGGGTCAGATCCTGAATGT
TCTGATTTGGTCTGAGATTGAATGCTCTGATTGGTCAGTA
CCTGGATGTTCTGAATGGTCAGATCCTGAATGCTCTGATT
GGTCAGTGCCTGGATGTTCTGATTGGTCAGATCCTGAATG
TTCTGATTGGTCAGTGGCTGAACGTTCTGATTGGTCAGAG
CCTGGATGTTGATTGGTCAGTGCTTAGTGCTCTGCCCGGT
CCGATCCTGAATGTTCTGATTGATCAGTGGTTGAATGTTC
TGATTGGTCAAATCCTGGATGTTCTGTTTGCTTACCACTT
GATTGTTCTGATCGGTCAGATCCTGATTGGTCAGTTGTTT
TTCTGGTAGATCAGTGCCTGGATGTTCTGATTGGCCTGAG
CTTAGTCAGTGTTCTGCTTGGTCAGATACTGAATGCTCTG
ATTGGTCAGAGGCTGGATGTTCTGATTTATCAGTGCCTGA
TTGGTCAGTGGTTAAATGCTCTGATTGGTCAGATACTGCA
TGTTCTGATTGCTTAGTGCTTGATAGTTCTGATTGGTTAG
TGCTTAGTCAGTGTTCCGATTGCTTAGATCCTGGATGTTC
TGATTGATCAGTGCCTGATTGTTTTGCTTGGTCAGTGGTT
GAATGCTCTGATTGGTCAGCTACTGCATGTTCTGATTGCT
TAGTGCTTGATTGTTCTGATTGATCAGTGTCTGATTGTTT
TGATTGATCAATCAGAACATTAAACCACTGATCAATCAAA
TCAATCAGACACTGATCATCAATCAGAACATTAAACCACT
GACAGTGTCTGATTGTTCTGATTGGTCAGTGGTGTAATGT
TCTGCTTGGTCAGTGCTTAGTCAAGTCATAACCTGGATAT
TCTTATTGGTCAGGGGAATGTTCTGATTGGTCAGCGTTCT
GATTGGCCAGCGGTTTAATCTTCTGATTGGTCAGCTGTTA
GTCAGTGTTCTAATTGGTCAGTGGTTAATGTTCAGAGCTT
TAAAACTTCACAGTCTCAAGTTGAGATGTCATTTCTCTTG
CTTTGTTAGTTTTCTTAAGAAAACAATGAAAAAAAGTGCC
AAGTTGCACGTTATTTTTACGTTATTGACAAGTATTACTG
ATCATATTTCAAATATTCCTCGTTTTACCCATACGCAACA
GGATGTGAGCTCTAGCTTGAGTTAACCTTGTATCCGTGGT
TCTCGTGATCTCCAATATAAACTAACACTACATTTAAAAT
GGCATTTATGAAATGCAAATGTTTCACCGTATGCCTTTTC
TACATGTATCTCTGTGTGATATCATTTCTGTCATAGCATC
ACTTATGTGTATATCGCTGATACTAAGGTCTAATAAAGAC
TTTATCCAAACGTCCTCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations