ZFIN ID: ZDB-TSCRIPT-131113-1349
Transcript Name: ptprfb-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059102 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059102|OTTDARG00000010117|ZDB-GENE-060503-530 ptprfb|no_translation ptprfb-003 LG_none BX663493.8,BX248089.5,BX284693.6,BX511224.8 Danio rerio protein_coding KNOWN, 524 bp
CTGGATTCACAATTTTACAACAATAGAAGCTTTTCCACTC
CGCTGTAGTTATAGCGACCGGTCTCAATAACGGGATTATA
ACGGCCGCGTGGCACATTAGTAAAGGAAGGGGTCGTTACT
CTGTGGAATCGAAGAATTTTTCCAGTCGATTTTAAAAGTG
GATTTGTACGTGGCCAAGTGAACCCGGTGAAGCAAGAGGC
TGCCGTGCACGGAAAGAAATGCAAACCGCGGCGGAACGGA
GAGACGGTTTTAGTCTATGATTGCTTGAGAGCTGCAAGAG
CAGAGCGGGGATCGAGGAGGAGCAGTGCCAACCTGGAACA
TGGTGCCTAACACTTGCACATCCGTGCCCCTCCTGCCCGT
CGGGCTTCCTCTTCTGCTACTGCTGAGCTGCATACAATTC
TCCTCTCAGGCAGACAGTAAGTACAACACTTCAGCTGACT
AGTCATTTTTTTCCCTTCGTCCTTTTTCCTGTGCCTTGTG
AAATTGGAAGTGCATCGCATTGTGGAATTGTTTGCAGGCA
TGAG

ptprfb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ptprfb-201 (1)    Ensembl 7679
ptprfb-202 (1)    Ensembl 442
ncRNA ptprfb-003 524
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptprfb-003 Contained in:

Genome Resources: Vega_Trans:OTTDART00000059102 (1),  Ensembl_Trans:ENSDART00000155124 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL919034 (1) 518 nt
CITATIONS (2)