ZFIN ID: ZDB-TSCRIPT-090929-2026
Transcript Name: ptprfb-201
Previous Names: ptprfb-001, si:dkey-21k10.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011618 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011618|OTTDARG00000010117|ZDB-GENE-060503-530 ptprfb|OTTDARP00000010017 ptprfb-001 LG_none BX663493.8,BX248089.5,BX284693.6,BX511224.8 Danio rerio protein_coding KNOWN, 7679 bp
ATCAACTCTCTCCACAATCAACTCAAACAAGTGGACTTTT
ACAAACTGTGGATAAAGACTCGTTCAGCGTCAGTTGGATT
GACTTTTAAGGAGATAAAAAAGCTCTGGTTGGTCTGTTCC
AATAACAAGGATCTTCCCACCTGGATGTTACAGGGATTTG
ATGGCAGTCACTTTTGGGAATAACAGTTAAGACGAAGACG
AAGAAAACATCAGGGATTTAAGCAAAAGGATTACTCTTTC
CTCATTTTTTAATTTATTTATTTTTGAGTGGATGTTTTTT
TTAATTTCATATTGTTATGGGTTTTAGTCTATGATTGCTT
GAGAGCTGCAAGAGCAGAGCGGGGATCGAGGAGGAGCAGT
GCCAACCTGGAACATGGTGCCTAACACTTGCACATCCGTG
CCCCTCCTGCCCGTCGGGCTTCCTCTTCTGCTACTGCTGA
GCTGCATACAATTCTCCTCTCAGGCAGACAGCTTGCCAAA
TTTCGTCAGATCTCCAGAGGACCAGACGGGGATTTCAGGA
GGAGTGGCGTCTTTTGTGTGCCAAGCAGCGGGTGAACCCA
AGCCTCGCATCACATGGATGAAGAAAGGAAAGAAAGTCAG
CTCGCAGCGCTTTGAGGTGATTGAGTTTGATGATGGTTCG
GGCTCAGTTCTGCGCATTCAGCCACTGCGAACTCACAGAG
ACGAGGCCATCTATGAGTGCACAGCCACCAACAGCCTGGG
GGAAATCAACACCAGCGCCAAACTCACCGTGCTGGAAGAA
AATCAGATTCCGCATGGTTTCCCCACCATAGACATGGGTC
CTCAGCTGAAAGTGGTGGAGCGAACAAGAACAACTACAAT
GCTCTGTGCTGCCAGTGGGAACCCTGACCCGGAGATCACT
TGGTTTAAAGACTTCCTGCCTGTAGACATCAACGGCAACG
GGCGAATCAAACAGCTTCGCTCAGGAGCTCTGCAGATTGA
AAACAGCGAGGAATCAGACCAGGGCAAGTACGAATGTGTG
GCTACGAATAGCGCCGGGACGCGTTATTCAGCTCCGGCTA
ATCTCTACGTGAGAGTACGACGAGTTCCACCCCGTTTCTC
CATCCCACCTACCAATCACGAGGTGATGCCAGGGGGCAGT
GTAAACCTCACCTGCGTGGCAGTAGGTGCCCCGATGCCCT
ACGTCAAATGGATGACTGGTGAGGTGGAGCTCACCAAGGA
TGAGGAGATGCCTGTGGGACGCAACGTCTTGGAGCTCACC
AACATCCGTCAGTCGACCAACTACACCTGCGTGGCTATAT
CATCCCTAGGTATGATCGAGGCAACGGCACAAGTGTCTGT
CAAAGCTCTCCCAAAGCCTCCTACATCCCTGACTGTTACG
GAAACCACAGCTACGAGTGTTACACTCACATGGGACTCTG
GAAACCCTGAACCTGTGTCTTACTACATAATTCAATACCG
GGCCAAGACTTCAGACACCAACTTCCAAGAAGTGGACGGT
GTGGCCACCACACGTTACAGCATCGGCGGTCTCAGCCCAT
ATTCAGAGTATGAGTTTCGAGTAATGGCAGTCAACAACAT
TGGTCGTGGGCCACCTAGTGAACCCGTTGAAACACGAACA
GGTGAACAGGCACCTTCCTCCCCACCGCTGCATGTTCAAG
CACGAATGCTGAGTGCCAGCACCATGTTGGTTCAGTGGGA
ACCACCAGAGGAACCCAATGGTCAGATCAGAGGCTATCGG
ATCTACTACACATCTGACCTGGATGCACCTCTTAGCGCCT
GGCAGAAACACAACACAGACGATAGCCGTCTCACCACTAT
CTCCAGCCTGACCACCGGCATCACCTACAGCCTACGTGTG
CTGGGCTTCACATCTGTAGGGGATGGACCACCATCTGATG
TGCTACAGGTCAAGACACAGCAAGGAGTTCCTGCTCAGCC
ATCCAGCTTCGAAGCTGAAGCAGAGCTAGATACAAGGATC
CTACTAACTTGGCTGTGGCCCGTGCAGGACCCCATCATCA
AATACGAGCTGCAATATTGGGAGGCTGACTCAGACAACAA
GATCCATGTCACCTTTGACCCAGCTGGCTCGTACGCTGTT
GAAGGTCTGAAACCAGACACTTTGTACAAATTCTCTCTGG
CAGCCCGCTCTGAAATGGGACAAGGAGTCTTCACTCACCC
CATTGAAGCCAGGACGGCCCAGTCTGCCCCCTCTGCCCCC
CCTCAAGACGTGCACCTGCTCAGTCTGAGCTCCACCAGCA
TCAAGGTGAGTTGGGTGGCACCACCCGCCGCTAGCCGCCA
CGGCGCAATAGTGCGCTACACAGTCAGCTACCAGGCAGTG
AATGGAGAAGACACAGAGCGCCATGAGGTGCCGGACATTG
GAGCGGATGCCTCCAGCTGTGTGTTGGAAGGTCTAGAGAA
GTGGACGGAGTATCAGGTGTGGGTGAGAGCGCACACTGAT
GTGGGCCCCGGCCCCGAGAGCACGGCTGTGCGTATCCGAA
CCAATGAAGACGTGCCAGGAGCACCGCCTCGGAAATTGGA
AGTGGAGGCTTTGAACTCCACCGCTATCCGTGTGACATGG
AAACCTCCTCTTTCTGGAAAGCAGCATGGCCAGATCCGGG
GATATCAGGTCATATACTCCCGGTTGGAGAACGGGGAACC
ACGGGGACATCCGAATATAATGGATGTCGCTCTGCCAGAA
GCACAGTGGAAAATTGAAGAGTCTACGGAATATGAGGCTG
TGATCGCTGGACTTGCCTCTGAAACCTCTTACTCAGTGAC
TGTGGCTGCGTACACAACCAAAGGTGATGGAGCTCGCAGC
AAAGCCAAAGTGGTCACCACCACCGGAGCAGTGCCTGGCA
AACCCACTATGATCATCAGCACCACCGTTGGCAACACGGC
CCTTATCCAGTGGCAGCCTCCTAAAGACATGGTGGGTGAG
CTGATGGGCTACCGGCTGCGCTACAAACGTCTGGAAGAGG
AAAACTATGAGATACGCGAATTCAGTCGCACCGACGACCA
CCACACCGTCACTGACCTGCACAAGGGCGCCACCTACAGC
TTCCACCTGAGCGCCAGAAACCGCGCTGGACTCGGAGAGG
AGTACGTTAAAGACATCGGCACTCCTGAGGACGTGCCCAG
CGGGTTTCCTCTTAACCTGCAGGTCGTAGGCTTGACTACC
TCTACCACCCGACTGACCTGGGAGCCTCCAGCGTTGTCTG
AACGTAACGGACGGATCATACATTACATTGTGGTTTACCG
AGACATCAACAGCAAACAAAACAGCACCAACCGAACCTCC
GACACACAGATGACCATCCAAGGGCTCCGACCTGACACCA
CCTATGATATCCGTGTGCAGGCGTTCACTAGCAAGGGTGG
AGGTCCCATAAGTCCCAGTATCCAGAGCAGGACCATGTCT
ACGTCACCTGCATTTGCCACAAGTTTTGGTGTCAAAGCTG
TGATGAAAACCTCTGTCCTTCTCACCTGGGAGGTGCCAGA
AAATTATAAATCACAAGTGCCTTTTAAGATCCTCTATAAC
CAGCAGAGTGTGGAAGTCCAGGGGAATCTGAAGAGGAAGC
TGATCACACGCCTGCAGCCGGACACTGATTACTCGTTTGT
GCTGATGAGCCGGGGAAACAGCGCCGGTGGCCTACAACAG
CAGGTCTCCATCCGCACTGCACCAGACCTGTTCAAAACTA
AACCTGTCCTGTACACGGCAGACCAGACCAACAATGGCAA
ACTCACCATCAACCTGCCCAAAGTGCCCACCTCTGCTCCT
GTCAGGTGTTATTACATTGTGGTCGTGCCCGTCTCTCAGA
CATCATCTCGTCAGTGGATTAATCCCGATGAGATGGAGCT
GGATGAGCTCCTGGAGTCTAGTGAGGGAGCTCATCTCAGG
AGACGTCGACGGCACACAGACACCGTAAGACCGTACATCG
CCGCAAAGCTATCCACGCTCCCAGAAACCTTCACTCTGGG
CGATGAGCTAGACTACAGCGGCTTCATCAACCGGCCTCTT
CCCAACAACCAACACTTCCAGTGTTTTGTGATGGCTGAAC
TCAAGGACCAATACCCTGTTACTGCCAATGAGAAGCAGCG
GACCTTCTCGGCTAGCCCATACTCAGACCCCATCATAGTG
CAGGGTGAAAACCAAATGCAGCGCAGTGTGGACCAACCGG
AGATGCTTTGGGTCATGGGCCCTGTGCTCGCTGTGGTGCT
CATCATCATCATAGTCATCGCCATCCTGCTCTTCAAAAGG
AAGAGGGCTTCCCCCCTACCAAAAGACGATCATTCGGGTG
GTGTGAAGGATTGTCTTCTGGCCAGCTCATCCGATCCTGT
CGAAATGAGGAGACTCAACTACCAGACACCAGGAATGAGG
GAACATCCTCCCATATCCGTCTCCGAACTGGCAGACCACA
TCGAGCGCCTCAAGGCCAACGATGCCCTCCGGTTTTCCCA
AGAGTATGAGTCTATTGATCCAGGCCAGCAGTTCACATGG
GAGAACTCCAACTTGGAGGTCAACAAGCCAAAGAACCGTT
ATGCCAACGTTATTGCTTACGACCACTCGAGAGTTGTTCT
CACCCCTGTGGACGGTGTACCAGGGAGTGACTACATTAAT
TCCAACTACATTGATGGCTACCGTAAGCAGAATGCCTACA
TTGCCACACAAGGTCCTCTGCCTGAGACTCTGAGCGACTT
CTGGAGGATGATTTGGGAGCAACGAGCCAGTACCATCGTC
ATGATGACCAGACTGGAAGAGAAGTCCAGAGTCAAGTGTG
ACCAATACTGGCCCATTCGTGGCACAGAGACTTATGGAAT
GATTCAAGTGACCATGCTTGATGCTGTTGAGCTGGCAACC
TACAGTGTGCGCACCTTTGCCCTTTACAAGAATGGCTCTA
GTGAGAAGCGCGAGGTCAGGCAGTTTCAGTTCATGGCTTG
GCCGGACCACGGAGTGCCTGAATATCCCACCCCCATCCTA
GCCTTCCTGCGCAGGGTCAAAGCCTGCAACCCTCCTGATG
CTGGACCCATGGTAGTGCACTGCAGTGCTGGAGTTGGCCG
TACAGGCTGCTTCATAGTCATCGATGCGATGTTGGAGCGC
ATGAAGCACGAGAAGACCGTAGACATTTATGGCCACGTCA
CGTGCATGAGATCCCAGAGGAACTATATGGTGCAGACGGA
GGACCAGTACATCTTTATCCACGAGGCCCTTCTGGAGGCC
GCCACCTGTGGAAACACAGAGGTCCCTGCCCGAAACCTCT
ACGCCCACATCCAGAAGCTCACACAGCCATCGGCTGGAGA
GACCGTCACAGCCATGGAGCTGGAGTTTAAGAGACTCGCC
AACTCCAAAGCCCACACCTCAAGATTCATCAGCGCCAACC
TGCCCTGCAACAAGTTCAAGAACCGGCTGGTCAATATCAT
GCCTTTCGAGTCCACACGGGTGTGCCTGCAGCCAATCCGA
GGAGTGGAGGGGTCCGACTACATCAATGCCAGCTGCATTG
ACGGATACAGACAGCAGAAGGCCTATATTGCCACTCAGGG
TCCTCTAGCGGAGACCACCGAGGACTTCTGGAGGATGTTA
TGGGAGCACAATTCCACTATTGTAGTGATGCTGACCAAAC
TCAGAGAGATGGGACGGGAGAAGTGTCATCAGTACTGGCC
CGCCGAGCGCTCAGCCCGCTATCAGTACTTCGTAGTGGAT
CCCATGGCCGAATACAACATGCCCCAGTACATCCTGCGAG
AGTTCAAAGTCACAGATGCCAGGGACGGTCAATCCAGAAC
CATTCGCCAGTTCCAGTTCACTGATTGGCCAGAGCAGGGA
GTGCCAAAAACCGGTGAGGGGTTCATCGATTTCATTGGGC
AAGTTCATAAAACCAAGGAGCAGTTTGGGCAGGATGGACC
AATCACTGTGCACTGCAGTGCTGGAGTGGGAAGAACAGGT
GTTTTCATCACTCTCAGTATTGTCCTGGAGAGGATGAGAT
ATGAGGGGGTGGTGGATCTGTTCCAGACGGTTAAAACCCT
GCGCACACAAAGGCCTGCCATGGTGCAGACAGAGGACCAG
TACCAGCTGTGCTACAGAGCCGCTCTGGAGTACCTGGGGA
GCTTTGATCACTATGCAACGTAACCACTCCTGGACCACAG
CCTTCTGGTACAACTCTTCAGGAGTGCACCAAGTGTTCCT
TCTGAGCCCCTGTCCCCCTGCCCCATCCTGTACAGAGATC
TGGGGCTGGGGGCGGGAAGGGCAGGCTATCCAGTGGCTGG
TTAACCAATCAGAGCAGTCCGTTATTGACCGGCACCAAGA
GATTGCTTTAAGAAACATAGACAACTCTCTTTCAAGAAGC
ACCATCTACAAAAAAAAAAAAGTCAAATAAACGATATTCT
AGTGGTTTCTCTTTAGCGAACGCCAACCCAGACTACAGTC
CAAGGCTACTGGTAGCACTAAATCTTCTTTTTCCTTCTCA
TTTGGCTATCATGATCATCATCCTTTGTTATTATTATTAT
TATTAATTCAGTATGACGATATTGTTTGTCTTATTTAGAA
TATTTGCATTTTTTTAAATCATTTTTTAACATTGTTTGTC
TTAACGGCCTTAACTGTGGGGTCGATCTTTATTTTCTTTT
GTTTGGTATTTTCTTTCTAATAGGTTATTTTAGCACAAGA
GCATGTGTTTTCAACATGTTCCTGATACTAATACCAGAGG
ACCGGCGTTCTCTGAGCTGCTGATGGTTTGACTTTGTAAC
ACGATTTTACTGTTTGTTATTTTCCTCGTTATGTATAATT
GGGCTGAAATAAGCGGGTTCAACTTGTTGGAGAAGCCTTT
AATAACGTCTCTTGTCTCTGAGAAACTCTCCAACCACAAG
ACGTATATATATATTTGGGTTAGTGGTACTAAATTAAGAA
GAAAATAAACAAGTGTTTGGTTAGGGGGAAAGAAAATCAA
CTAACGCATCAAATCAAGGCTGTACAGAACTCAGTAGTGA
TTTGTGAAGATTAAATATGGGGGGTTGAAAAAAAAACAGC
CCTCTCACCTGCTTTTCTAGGACATTTGAAGACCTGATAT
TGAAATGAGACCAATCGCCATCGGCACCTGTACAGTATAA
ACCACTCCTCGAAGGAGAGTCAGCTCTGTTTAATCCAACT
CTTCTTTTTATACAGAAATATACGAGATATATAGAAATAT
ATATACATTCAAAAAATGTATAATTATGAATAAATACTAT
TATAGATACAGTATATAAACAGCTTCTGCTCTATTGTCCA
TGAATCTCTCGAAACGTAACCCTGGACTTTTTCTTGATAT
ACCAACATAGAGTTAAACACGAGAGACTGCTGTATGTGAG
TCTATCCATGGTACAAAAGTTCTATCTACTGTATTATCCA
CGCACACCCCGGGTGTCTGGCGCTTTCTTCTGGTGGGTGG
GGGTGGAGCAGCACAAGTCGACTTAAAACACTTCCTACAG
GACGTCATGTTCATGCCTGCTCGATTACAACCGGCATGTC
AAAGGGACATCTGGCCATATATGTTCCGAATATGTTGGCA
GTGCATTTCTACCTTGTGAATGATTAGTGCTGTAGAGGTT
CCATCTGTTGTATACACAGTCTGTTTTCTATTTGTTAATA
AGAAAACTGGAATTTAAAAAAAATGTTGCAGGAAAAAAAC
TCGATGTTAATAAAGTTCAATAATTGGTTTTTGTACAAA

ptprfb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ptprfb-201 7679
ptprfb-202 (1)    Ensembl 442
ncRNA ptprfb-003 (1)    Ensembl 524
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptprfb-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000011618 (1),  Ensembl_Trans:ENSDART00000083314 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC134804 (1) 7718 nt
GenBank:CF347926 (1) 722 nt
GenBank:AL924690 (1) 535 nt
GenBank:BF938238 (1) 267 nt
CITATIONS (2)