ZFIN ID: ZDB-TSCRIPT-130528-614
Transcript Name: tprb-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058498 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058498|OTTDARG00000006191|ZDB-GENE-030131-6410 tprb|no_translation tprb-002 LG_ BX323056.5 Danio rerio protein_coding KNOWN, 731 bp
CTCTGATAATAACACACTCATTCAAAAGCGTATGACTTGG
ACTAACATTCTCAGCTTGAGAAAATGAACCACATATGCAC
TTTCCTCTAATTCTACTTTTCCCCTCCTTTCTACTACCTT
TAATTTTTCCCAGGGCCCTGATCCCACTGATCCGGGCACT
GAGACAGAAGAAAGTCTTGGAGCGACAGACTCCACTCAGC
GCATGGCAGATTCCCAGAGCTTTGAATCGAACACATTGGA
AATGTTTGAAGTCCCCGTCACCAGCTCCGCCCCTCGACCT
CCACAATCCCCCAGAAGGCCTCAGCATCCTCTGCCACCTC
GGCTAAACATTTTGGCTGCTCCTGCTCAGGAACTCGGGCC
TCCTGCTCAAGTACAGCGTCTTCCAGCTCGCCGGCAGTCA
GTGGGACGAGGCCTTCAGCTTGCTTCTGGAATGGCCAGTA
GTGCACAGCCTTTCTTTGAGGATGATGACAGGATGGTTCC
CAGCACTCCTACACTTCCTCTTCGCTCTGATGGATTTGCA
GAAGCCATACATTCTCCACAGGTGGCAGGTGTACCACGCT
TTCGATTCGGGCTTTTAGATGAGCTCCCGCAGACCAGCTC
CTCTCACTCAGACCTCAGTCAGCTGCCCTCACAAGGTTTA
GGCATGTATGAGAGCTCTGTTTTTTTGGGATCTCATGAGG
ATGAGTCAGGGGGACGCAGTGTACCCACAACCCCTCTGCA
GATCAGCGCTC

tprb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA tprb-201 (1)    Ensembl 7285
ncRNA tprb-002 731
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tprb-002 Contained in:
[BAC] DKEY-97O5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000058498 (1),  Ensembl_Trans:ENSDART00000152940 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CN170304 (1) 884 bp
CITATIONS (2)