header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-846
Transcript Name: tprb-201
Previous Names: tpr-001, tprb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006803 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006803|OTTDARG00000006191|ZDB-GENE-030131-6410 tprb|OTTDARP00000006056 tprb-001 LG_ BX323056.5 Danio rerio protein_coding KNOWN, 7285 bp
GGACGAGGAGGAGTCACCGGAACGAAAAATGGCGGCTGTG
TTGCAGCAGATACTTGAGCGGTCGGAGATATCGAAACTCC
AAAAAACAGTTTTGACTAAATTAGAGAAGTACATTTCTGA
GCAGCAATGTGAAGTTGATGACCTCAAGGCACAACAGGAG
CAATTTCGTGTGGATAGCGAACAACAGTATTTTGACATCG
AGAAAAAGTTCGCAGAGAGTCAGGCTCAGTTTGTGTCCCA
GACTCAAGAACATCAGATCCTGAAAGAGGAGCACTATAAA
TTGGAGGATGAGCTGAAATGTTTAAGAGAGAACAATAAGG
AGCAAGCAGCTTCATACGCCAAACTAGAATCTAAACAGAA
TGACCTTTCCAAAGCCAAAGATGAGCTCGAAGCAGAAAAA
AGAGAGCTGGTCCGTACACTGGAAAGAAGATCTCAGGAGA
TGGAACACCAAAGCGAGGACCTTAAGCGTCTTAATGATCG
ATTGGTGGAAGTCAGTGCAGAAAAAATGCAGCTTCAGCTC
AAACTGGAGGAGTCAGAAACCTCTGAAGTTTCAATCAAGT
ATAAGGAAAAACGAATGGAGCAGGAGAAAGATCTACTCCA
GTCTCAAGTGACCTGGCTGAACACTGAACTTAAAGCCAAA
AGTGAAGAACTGCTGTCTCTGTCCCGGCAGAGAGGCAATG
AGATCTTGGAGCTCCAGTGTAACCTTAATAACAAGGAGGA
CGAGATCACCCGCCTTCAAGATCAGGTGACCAGTCTGAAG
GCGTCCAATGAGACCTTTCAGAAGCAAGCAGAGGAGATGA
TCATTAAGATGAGAGAGGCAAAAGAACAGCAAGCTGCTTT
GGAAGAAAAGTTCAGTAATGAGCTCAATGCCAACATTAAG
CTCTCAAATCTGTACAAGGGAGCAGCAGCTGATGCTGAGG
CCAAGAGTGAAGAGCTCAGCAGAGCCGTTGATGAGCTTCA
TAAGCTGCTTAAAGAGGCTGGAGAGGCACATAAAGATCTG
GAAGTGAAGATGGCAGATCTGGAAAGTCATAAGAATAAGG
AAATTGCTGAACTTAAAGAGAAAATAAGCAGCCAAGAAAA
AGAGCTGGACAATGCCAACGACCTGTTGTCTGACAGCAGA
CACAGAGGAGCTGCTTCAATTCTTACAGAAGAGCAGGTGA
CCATAATGTCCCCCACTGCTGCTGCAGTTGCCAAAATGAT
CAAACCAGGCATGAAACTCACAGAGATCTATACCGCATAC
GTTGAGACCCAAGAGCATTTACAGCGTGAAAAACTCGAGA
ACAAGCGACTGCACAAGTACCTGGATGACATTGTGCAGGA
AATGGAAGCAAAGGCTCCTATACTGAAAAGACAGAGAGAA
GAGTACGAGCGCATGCAGAAATCAGTTTCCAGTCTCTCTG
CTAAATTAGAGCAAGCTGTCACGGAGGTACATCGCTTGCA
AAAAGAATCGGATGAAAGCAACAAGCGTGCATCAGTTTTG
GAAAGAGATAACCAGAGGTTTGAGGTTCAGCTGGCTGACA
TGGCTCAACAGGTGCGAGTTCTTCTCGTTGAGCTGGAGGA
AGCACGTGGTAACCATGTTATGCGGGAGGATGATGATGTG
GGTTCGGCAGATGTGAGCAGCACATCGGAGGTTATTTCTC
AGCACCTGGTCACTTTCCGTAGCGTTGAAGAGCTGCAGCA
GCAGAACCAGCGACTCCTAGTGGCGCTCAGAGACCTTAGT
GAGGAAAAGGAGAAGGATGAATTGGAGGGAGACACCATGA
AACGCAGTGAAGTGGAAAAATATCTCGAGGAGCTTCAGCG
AGAGTTGGAGCAGCTGAAGGAAAAGAGAACTCAAGATCTG
CAGAAGGTTGACACTGTGGCACGGCAGAGGGACATGTTCC
GCATGCTTCTGACTCAGACTACTGGGGTCACTTTCCCGCA
GGGTGCTGGAGCTGAGGAGCTTATGCTGACCTCTACGCCC
CGTCGTTCTCCAGCCGTTACACCCACCACTGGCACCCCTA
CAGCACTGGTTGCCACAGCCATAGAATCCACTGAGTCAGT
TGAGGCCAAGGCTGCACTGAAGCAGCTTCAGGAGGTCTTT
GTGGCCTATAAGAAAGAGAAAATTGAGTCTGAAAAGGCAC
AAATTGAGCAAAATGAGAAACTGCAGGATCAAGTTACCGA
ACTTCGCTCGGAGAACATGAAGATCTCCACACAGCTAGAG
TTCACGTCCAAAAGATATGAGATGCTCCAGGATAATGTTG
AGGGCTATCGTAAGGATATTGCCTCTCTGAATGAGAAGCT
TCAGAAACAGGCTGCAGCAATTCAGCAGAGTGAACAAACC
ACACACACCCTCACACAGGACCTACAAGCAGCAGCTGAGA
AGCTCTCCATTGCTGAGTCTGAATTGGAGAACCTGCGTAA
AGAGAGGGACATGTTGAAGCTAGTTGAGATCAGGCTGACC
CAGGAGAAAGAGTCCTTCCAGGCCCAACAGCTTGGCCAAA
ATATGCTGCTGACCAACCTCAAATCAATACAGACTACTCT
AGAGCGCTCTGAGACGGAGACAAGACAACGGCTGACTGCT
CAGATTGAAAAGCAGGAGAGAGAGATCACCCAGCTCCAGA
AGAGACTTGAGAATGAGGTGGAGCAGAAGCACCTGCTGGC
ACGGAATCAAGATGTGCAGCTGATGGACACTAAGAAGCAG
CTGGAAGCACAGATTGCTCAGCACCACAAGACGAAAGAAC
AGCTCAGTGCTGCACAGCTTGAGTTAACCAACTTGAGATT
GCAGTTGAATAGCGGGGAGAGCCGGCTGGCGTCCGCTGCA
GTACATACAGGTCTGCAGGGCAGTGAGAGGGACATGGAGG
TTCTGCGTGCCCAGATAAGGCAGACTGAGAACAGAATTGA
AGAACTGACAGAGCGACTTAAAAACACTACTGCCAGTATG
GAGCAATACAAGGCTATGAGTCTTAGCCTGGAGGAGTCTC
TAGATAAGGAGAAGCAGGTAACTGAGCAAGTTCGTTCATC
TGTAGAAAACCAAGTGGAGGCAGCTCAGGAGCAGTATAAA
CGGCTAGAGCAGAAACTGCTGGAAATGGACAAGGAGAAAC
AGAACTTGCTGGAAGAGAAAAACAAAGCTGTTGCTGCTGT
AGAGCAAGAGCTAACGGAGCTGAGAAAGTCTCTCAGCAGT
GTGCAGGCAGAGCTCCAGAGTGCCCAGGAGAAAGCAGCTG
TGGCTGCGGCACAGGAGCAGCAGGCCTTACTGGATGGTCA
GGAGCAGGCTAAGATGGCAGCTGAGGCACAAGATAAATAT
GAGAGGGAGATGTTACTGCATGCGGCAGATGTGGAGGCAC
TGCAGGCTGCCAAAGCTCAGGCTCAACAGGCTTCTCTTGT
CAGACAGCAGCTGGAGGAGAAAGTACAGATCACCAGCGCT
CAACTGCTAGAGGCTCGTGTGTCATGGGAGGAACAAGAGA
AGATTCTTAAGGAGGAGCAGTGTAAGATCCAGTCCCGCTG
TGAAAATCTGCAGAGGCAGAACAAACTCCTCCATGAGCAG
ATCCAGACTCTGAGTGGACAGATGGCAAGTCAGCTGAAGC
GAGCCACCACTGAGAGTCCACTCAACGTCTCCCTGACTGA
AGAAGGAAAGTCTCAGGAGCAACTTCTTGAAATACTCAGA
TTTGTGCGCAGAGAGAAGGAGATCGCAGAGTCTCGGTTCG
AGGTTGTCCAGGGGGAGAGTCTGAGGCACAGGCTCAGAGT
GGAGCATCTGGAGAGAGAGCTGAAGGATATGCAAGAGAGT
CTAAATGCAGAGAGAGAGAGGATGCAGGTGACTGCAAAGA
CTCTAGCCCAGCACGATGAGCTGATGAAGAAAACTGAGAC
CATGAATGTCCTGATGGAGACCAATAAGATGCTGAGAGAG
GAGAAGGAAAAACTGGAGAAGGAGTTGCAGGATACTCAAG
CCAAGATACGTAAACTAGAGTCCGACATCATGCCGGTGCA
GGAGTCCAATTCAGAGCTGAGTGAGAAGAGTGGCATGCTT
CAGGCAGAGAAGAAACTTCTGGAAGAAGACATCAAACGCT
GGAAAGCTCGCACTCAGCACCTGGTGAGCCAGCAAAAAGA
CACTGACCCGGAAGAGTACAAGCGTCTGCACTCTGAGCGG
GAAGCACATCTTAAACGCATCCAGCAACTTGTTGAAGAAA
CCGGCCGACTAAAAGCTGATGCTGCCAGGAGCAGTGGCTC
TTTGACTACTCTGCAGTCTCAAGTGCAGAACCTAAGGGAG
AACCTCGGAAAGGTGATGGTGGAGAGGGACAACCTGAAGA
AAGACCAGGAGGCCAAAATACTGGACATCCAGGAGAAAAT
AAAAACCATCACACAAGTTAAAAAAATTGGTCGTCGGTAT
AAAACACAATATGAGGAGCTCAAGGTTGAATATGAAAAGT
TGGTAGCAGCGGCGGCATCTGCACCAGCCCAGGATCAGGA
GGCACAGCAGGCATCAGCTCAAGAACTTCAGAATCTTAAA
GAGTCCCTCAATCAATCAGAGACCAGGATAAGAGAACTGG
AAGGCCAACTAGAGAATCTCAATAGAACTGTAGGAGAGCG
AGAAATGGAGGCCCGCAGTGCGCAGGAACAAGCCTCTCGT
TTGCAGACAGAGTTAACGCGTCTCAGACAAGAGCTTCAGG
AGAAATCATCTCAGGAGGAGCGTCTCAAACAGCAGCTGAC
TGAAAAGGAGGAGAGGACCAAGAAGGCCATATTATTGGCC
AAGCAGAAGATCAGTCAACTTACTGGTATAAAAGGACAGT
TTCAGAAGGAGAACGAGGAGCTGAAGCAACAAAAAGAGGA
GTTGGAAGTGCGTGTGAGTGCGCTGAAGTCTCAGTATGAG
GGGCGTCTGAGCAGACAGGAAAGGGAGCTACGAGACCTTC
GCGAACAGCAGGAGAGACATGGAGAACAGAGGGATGAACC
ACAAGAGCAGGGCTCCAGCAAGACCCAGGAACCACAAAGG
ACAACAGAACAGCGACAGATTTCTCTGAAGACAACCCCAG
CGGCAGAAAGAGGAAGTGCTAGCACTTCTGAGCCCCCAAC
AGCCAACATAAAGCCCACACCTCTGGCAGCAACCCCCAGC
AAGCCTCAAGTCATTCCTGGAAACAAATCCACTCCAAGAG
CCAGCATCAAACCCATGATCACTCCTGCCCCGGTGCCCAC
TCCTACACCCACTGCCACAGTCATGCCCACCACACAGGTG
GAAAGCCAAGAGCCCATGCAGTCCTCAGAGTCCCCATTGG
AGCATGTGACTGTGTATGGCAGTGCCAGTGGTTCAGTAAG
GTCCACGAGCCCTAATGTTCAGACCACCCTGGCTCAGCCT
CTGCTGAACGTTCAACAGCAGAACCAAGCTACTGCATTCA
TCCAGCCCACCCAACAACAAACCCAACCCCCTGCTGAACC
CTCCAATCAGGAGCCCCCAGCTGCTCTAATGCTGCCAACC
TCACAGTTAGATAGGCCTCTTTCTACATCCACAGGGCTCT
GGAGCGCCACCCCTAGCACAAGCAGTGCCAGTGCAGTTTC
TGCATCTCCTGGTAGTGCCTTAAGCAAGCGCCCCCGTGAA
GAGGAACAAGAGAGCATGTCTGCTGACACACAGTCCCAAG
ATGAGCCCAATGACTCTCCCACTTGCAAAAGGCTCCGAAT
CCATAGAGTGGGGTTGGAGGAAGAGATGTTGGCTGAGGAC
AGCACTGAGGCTGAAAGCGTTGTACCGGGTGAGATCCAGG
AGGCTCCTGATGCTGGACAGGAGCTGGAGAACTACTCTAC
TCTGGAAGAAATGGATGAGGAACCAGGACCATCTCAGTCT
GTCCCTGGAGATCGAATGCTGCCCCATCCATCTGAGACCC
ATCGAAGCCCAGAGGAGCCCGATCACCACGTCATAGTCAT
TGTTAGTGACACCGAGAGCGAAGGAGAACAGGAAGAGGAG
TCTGAGGAGGAGGAGGAGGAAGAGGAAGAAGAGCAGGATT
ATGAGGAGGAGGATGAGGAAGAGGAGGAAGAAGATGATGA
TGATGATGAAGAGGATGGAGGGATTGGGGAAGAGGGAGAT
GAAAGCAATGAGGAGAGTAGAGACGACAATGAGGCCTACG
AAGGAGATGACACAGAGGGCCCTGATCCCACTGATCCGGG
CACTGAGACAGAAGAAAGTCTTGGAGCGACAGACTCCACT
CAGCGCATGGCAGATTCCCAGAGCTTTGAATCGAACACAT
TGGAAATGTTTGAAGTCCCCGTCACCAGCTCCGCCCCTCG
ACCTCCACAATCCCCCAGAAGGCCTCAGCATCCTCTGCCA
CCTCGGCTAAACATTTTGGCTGCTCCTGCTCAGGAACTCG
GGCCTCCTGCTCAAGTACAGCGTCTTCCAGCTCGCCGGCA
GTCAGTGGGACGAGGCCTTCAGCTTGCTTCTGGAATGGCC
AGTAGTGCACAGCCTTTCTTTGAGGATGATGACAGGATGG
TTCCCAGCACTCCTACACTTCCTCTTCGCTCTGATGGATT
TGCAGAAGCCATACATTCTCCACAGGTGGCAGGTGTACCA
CGCTTTCGATTCGGGCTTTTAGATGAGCTCCCGCAGACCA
GCTCCTCTCACTCAGACCTCAGTCAGCTGCCCTCACAAGG
TTTAGGCATGTATGAGAGCTCTGTTTTTTTGGGATCTCAT
GAGGATGAGTCAGGGGGACGCAGTGTACCCACAACCCCTC
TGCAGATCAGCGCTCCTGTGACAATTCTCTCAGAGGCTGC
TGTATCTGAAGCGAGTGAACATGCTTCTCAGTCTGTGCCG
ATGGTGAGCACCTCTACCCCAGGCCTCAGTGCTCCAGCAG
TGGAGGAGAGAGACGACATGTTCCTGGATGCAGGAGACAG
TGCTGAAGCTTCACTTGAGGCCGTGTCTCAGACTGAGGCA
GAAGAAGCAGCGCAGCCTTCAGATGATGCAAATCTGCCTT
CAACAAGCCAGGAACCATCATCTAGTTCAGCAGACACAAG
CAGCTCTCAGCCTCCTAAAGCCAGGAGCGGCTCTGGCAGA
CAGTGGACTGGTAGTCGAGGTTCTAGAAGCATTGTGAAGA
GGGATGGACTGAGTGTTATGGGTGTGAGAGGACGCTTTGC
CAGATGAAGCAAAATCCCAGCAGTCTTCATTCTAGTCTTC
ATCCTGAACTATTGGCTCCACAAGAACAGCTGTGCTTTAT
TCTGCTTCAGGACTTCAAGTCAGTGTATTATAGCTGTCGT
TTGTTAGTTGTATGCTCTGAGCAATCCATTGTTGTTATTT
TTAATGATTCTACATCCATAAAATAAATTGTTTTGAAGAA
AGAGA

tprb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA tprb-201 7285
ncRNA tprb-002 (1)    Ensembl 731
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tprb-201 Contained in:
[BAC] DKEY-97O5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000006803 (1),  Ensembl_Trans:ENSDART00000017941 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AW344264 (1) 756 bp
GenBank:BG303765 (1) 733 bp
GenBank:BG302517 (1) 693 bp
GenBank:AW305782 (1) 675 bp
GenBank:CD594721 (1) 650 bp
GenBank:CD596046 (1) 650 bp
GenBank:AW343372 (1) 622 bp
GenBank:EH548156 (1) 592 bp
GenBank:EH569274 (1) 580 bp
GenBank:AL920956 (1) 535 bp
GenBank:CD583579 (1) 500 bp
GenBank:CD585533 (1) 500 bp
GenBank:BM316429 (1) 491 bp
GenBank:CB365547 (1) 186 bp
CITATIONS (2)