header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-130528-556
Transcript Name: si:dkey-85n7.7-203
Previous Names: dkey-85n7.7-004, si:dkey-85n7.7-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058318 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058318|OTTDARG00000034620|ZDB-GENE-110408-52 si:dkey-85n7.7|OTTDARP00000045599 DKEY-85N7.7-004 LG_ BX255913.8 Danio rerio protein_coding NOVEL, 368 bp
AGAAGCCGAAAACATACTCCTCACTCATTGCATGACTTCA
AGGCAGACATAATAAAAAGTTGTTGCAGATAAAATGGGCA
AGAAATAAGGGATATCTTGGAGCGCTGGCCTGCATTATCA
GATGCAACACAGATAAATGAAGAATTCAAGAGGATAACCA
CTGTAGGTCTTGAATCCACATTTATGGCCAAACTTGACAA
ATGCAGCCCAAAAGTAATGGACCTGGCCTCATCAAGGGGA
GGAGCTAAAGGGGAAAGAATCAGAAGGATTAAGGATATGC
TTCTTGAGAACAATGCAGTTGAAGTATGGAGAGAAGTAGC
CATTCACTGTCTTGTTGTCTATCTTGGAGAGAAAGAAGAG
GATCTTTT

si:dkey-85n7.7 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-85n7.7-003 (1) 280
mRNA si:dkey-85n7.7-201 (1) 1221
si:dkey-85n7.7-202 (1) 871
si:dkey-85n7.7-203 368
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-85n7.7-203 Contained in:
OTHER si:dkey-85n7.7-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058318 (1)
  • Ensembl_Trans:ENSDART00000153121 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK695647 (1) 366bp
    CITATIONS (2)