ZFIN ID: ZDB-TSCRIPT-110325-2200
Transcript Name: si:dkey-85n7.7-202
Previous Names: dkey-85n7.7-002, si:dkey-85n7.7-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049027 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049027|OTTDARG00000034620|ZDB-GENE-110408-52 si:dkey-85n7.7|OTTDARP00000045598 DKEY-85N7.7-002 LG_ BX255913.8 Danio rerio protein_coding NOVEL, 871 bp
AGACCATTTGGCACAAAGGATACTTTAAGAACTGCAATTT
CAGAACTAACATTTATGGTACATTTGCTTCCCACAGAAGC
CGAAAACATACTCCTCACTCATTGCATGACTTCAAGGCAG
ACATAATAAAAAGGTATGTATGTTCATTCAATGCAGATCA
ACACAGTGATGTGGAAGGTCAAAGTGGGGATCTGTCTGAT
GAATGTCAAGATGACAATAATGATGTGACAGACCTGCCAA
ACTGCATAGAAAAAAAATAGCTTTGTTGTTTCTAAAACTG
GAGAGCACTTTTAATGTATCTTACAGGTGTATAGAAGAGG
TTGTTAAAGAGTTAAATTTTATATCTCGATCAGCATCTGG
ACCCATCATCAAAGTTGTTGCAGATAAAATGGGCAAGAAA
TAAGGGATATCTTGGAGCGCTGGCCTGCATTATCAGATGC
AACACAGATAAATGAAGAATTCAAGAGGATAACCACTGTA
GGTCTTGAATCCACATTTATGGCCAAACTTGACAAATGCA
GCCCAAAAGTAATGGACCTGGCCTCATCAAGGGGAGGAGC
TAAAGGGGAAAGAATCAGAAGGATTAAGGATATGCTTCTT
GAGAACAATGCAGTTGAAGTATGGAGAGAAGTAGCCATTC
ACTGTCTTGTTGTCTATCTTGGAGAGAAAGAAGAGGATCT
TTTCAAGGAGTTTGCTAATACACAAGGAATTGAGGCAGAC
CTTAAAAAGCAAGTGATGAAAATTGCCATCATTGGTGATC
TGTCAACTATGGAATTAAACCACAAGACGGGACCCATCAT
TGTTGAGGGAATCAGAATCCTGATTGGAATGGATATCTCA
AGGTGTTGTGCTCTGCTAACGGGCATAATAT

si:dkey-85n7.7 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-85n7.7-003 (1) 280
mRNA si:dkey-85n7.7-201 (1) 1221
si:dkey-85n7.7-202 871
si:dkey-85n7.7-203 (1) 368
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-85n7.7-202 Contained in:
OTHER si:dkey-85n7.7-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049027 (1)
  • Ensembl_Trans:ENSDART00000149732 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO799699 (1) 897bp
    GenBank:EH594679 (1) 583bp
    CITATIONS (2)