ZFIN ID: ZDB-TSCRIPT-130528-49
Transcript Name: si:dkey-85n7.7-003
Previous Name: dkey-85n7.7-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058319 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058319|OTTDARG00000034620|ZDB-GENE-110408-52 si:dkey-85n7.7|no_translation DKEY-85N7.7-003 LG_ BX255913.8 Danio rerio protein_coding NOVEL, 280 bp
AGACCATTTGGCACAAAGGATACTTTAAGAAGCCGAAAAC
ATACTCCTCACTCATTGCATGACTTCAAGGCAGACATAAT
AAAAAGGTATGTATGTTCATTCAATGCAGATCAACACAGT
GATGTGGAAGGTCAAAGTGGGGATCTGTCTGATGAATGTC
AAGATGACAATAATGATGTGACAGACCTGCCAAACTGCAT
AGAAAAAAAATAGCTTTGTTGTTTCTAAAACTGGAGAGCA
CTTTTAATGTATCTTACAGGTGTATAGAAGAGGTTGTTAA

si:dkey-85n7.7 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-85n7.7-003 280
mRNA si:dkey-85n7.7-201 (1) 1221
si:dkey-85n7.7-202 (1) 871
si:dkey-85n7.7-203 (1) 368
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-85n7.7-003 Contained in:
OTHER si:dkey-85n7.7-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058319 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK696259 (1) 284bp
    CITATIONS (1)