Transcript

si:dkeyp-117h8.4-004

ID
ZDB-TSCRIPT-130528-543
Name
si:dkeyp-117h8.4-004
Previous Names
  • dkeyp-117h8.4-004
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058279 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058279|OTTDARG00000011185|ZDB-GENE-030804-4 si:dkeyp-117h8.4|no_translation DKEYP-117H8.4-004 LG_ CR352243.7 Danio rerio protein_coding NOVEL, 520 bp
CTAAGCGATGCTGGAATAGACATCTGTCTGAAAACAATGA
CCTGCAGGACTGGAAGAGGTCCTGTGCCCATTGACAGTGC
AGAGGGAGAACGTGAGCTGGAAGCATTAAAGACTCGAGTT
AGAGCAGACTATTCAGTGAGGGAGTTTGAAGACCAGGAAA
ATGATAAGATGGACATGTCAGGGGTCACCGAGGATGATCT
TAACGGCTCTGGTCAACAGGAAGACAGCAAAAATCTATGG
CACGGAGCTGAATCATTCCAGCAATCAAAACATCAATAAT
CTCCCAACTCTCCTCATTGGACAAAGACTGTTTCAGGGAC
CGCCTACATCCTCCTGTTCCCTCGCCTCACCGTAGCTTCA
TTGGTGTCTTATCTCCAAATGGGAAAAGCACCTTCAGACC
AAGCATTCTGAACATGGAAAGACAAATAAACTCGATAGGA
AGTCCAAACAGAAGGTCTTCTGTAATCCACCAAGAGCTTC
TTAGATCTCCTTATGGTGCCAAACAGGTGCCATTTTCATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations