Transcript

si:dkeyp-117h8.4-201

ID
ZDB-TSCRIPT-090929-2381
Name
si:dkeyp-117h8.4-201
Previous Names
  • si:dkeyp-117h8.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013002 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013002|OTTDARG00000011185|ZDB-GENE-030804-4 si:dkeyp-117h8.4|OTTDARP00000011168 DKEYP-117H8.4-001 LG_ CR352243.7 Danio rerio protein_coding NOVEL, 2417 bp
ACTCGGGAAATTCGAAAGTTTAACCGAACCGCTGCGTCAA
AGCATATATTGGTCAAATAAACTTGGCTTGTAGTAGAATT
TATTTATGCAACATGCCTTTATATACAGATCAGTTCAAGA
GAAATAACGATGTCTTCAGAAACACAATGGAAGCGATTTT
TCAAAAGTATTCCAATCTAAGCGATGCTGGAATAGACATC
TGTCTGAAAACAATGACCTGCAGGACTGGAAGAGGTCCTG
TGCCCATTGACAGTGCAGAGGGAGAACGTGAGCTGGAAGC
ATTAAAGACTCGAGTTAGAGCAGACTATTCAGTGAGGGAG
TTTGAAGACCAGGAAAATGATAAGATGGACATGTCAGGGG
TCACCGAGGATGATCTTAACGGCTCTGGTCAACAGGAAGA
CAGCAAAAATCTATGGCACGGAGCTGAATCATTCCAGCAA
TCAGTGAATTTAAACACCACATCTCCTGGGTCTTTGTGGA
GTGAGTTATCTTTGCCTAAGGAAGAGGATGAGGAACTGGA
GAAATCTTTGAGCAGCAATGGCAGCACTCTTTTGGATGTC
TATCCCAGCATGCTTAACCAGATTGGTGAAGCATACCGGC
GCCAACACTTGACTGATACGGCGAGATCTGTGGTACAGAA
GTATCGCCGCAATCACTGGCAAACTGGTCCAACACAGCGC
AACACATCCTTCAAAAACAGACACGGCTGCACATTAAACA
AAACAACAGATATCTCATTCTCCAATCAAATTCAAAGTCC
AGCACAAAGAAACATCGGTAACTGTTTCAAGGGTAGTCCA
AAACTACAAAATCTACTCAAGAACAAACTAAAGTCTTCTC
CACTCAATATATCCTACGAGTCCAGTGCCTGTTTTTACTC
ACCCAGAAGGAACAGCGTAGATGTGAGCGGTGTGACGGAT
CAGTCTGCATGGATTGATGTAGCTTTAACCAGGAAGCCGG
AGCAGAATCCTGCTCGTGTGATTGACTTCTCAACACCTTC
ATATTCTGGTTCCCCTTCACATAGTGACAAATCTCCAGAT
CTGGACCAGACCTATGATGTTGAACCAACATCTCCTGCTG
TTCCAACCTTATCGATCTTGACTTCTCCACAACAAAGCAG
AGCAGGTCTGTCTATTACTGACCAGAGAGAAACATCAATA
ATCTCCCAACTCTCCTCATTGGACAAAGACTGTTTCAGGG
ACCGCCTACATCCTCCTGTTCCCTCGCCTCACCGTAGCTT
CATTGGTGTCTTATCTCCAAATGGGAAAAGCACCTTCAGA
CCAAGCATTCTGAACATGGAAAGACAAATAAACTCGATAG
GAAGTCCAAACAGAAGGTCTTCTGTAATCCACCAAGAGCT
TCTTAGATCTCCTTATGGTGCCAAACAGGTGCCATTTTCA
TCACAAAGACGACCTGTTTATGACAACACTGATCAAACTT
CCTCTAAGGTAGAGAGTCGGTCCCATTTTACACCATTAAA
ACGCCAACGCTCTTTTTCTGGCTCCCCGTCCTCATACTCA
TTCAGTGGATCTCAAATTGATGCGGAGTTCAGAAAGCTGT
ACCACCACTTCATCTGCCGTGGAACATCATCACCCTGTGC
TTCCTCCCATTGTCATCTGTGCGAAAGACACACAAAGGAG
AGCTTCCAAAGCCCTGGCTTTTCCTCCTCCAGCATGTCTG
CTCTGGCTTTGACGCCTCTGAGAGCCAAACTTAAGAAACG
GAGCCGTCAGCCTGAAGTGGAAGAGTCACTCCGGTTTAAA
CGCTTCAGAGAGAGTCGCTCCCCACTGAAACATTTCCAGC
TGACAGATCTTCATGAGGACAAGCATGCTTGGGACAGAGG
CGTCCTCCTGCAGTGCCCCAGTCCAGGCTTCCTCAGGGGC
ACCGGAAACCTCAGAAGAATCCGTGAGGAGAAATTGAAGA
TGCAGATGAACCAACATGCTCTGTCTTGGAGAGATGCCCC
AAGCGGAGTCCACCTACTTGAAGCTGCGTCACCTATGAGA
CATTTTAACCAAGCTACCGCTTCACACTCTCCAAGTCTGT
CAAGGAGGCGACTGCAGTACAGTCTTCTACAGTGAAGAAC
CACAGCCTGCATGTATTCCCTTGAGAGGAAACACTACTCA
TTTCAAGAGTTCTTTTAAGTTCCTTTTAACTGCCCTAGTG
AAAACCTGGGGGGTGACCGCAAGTTAAACTGAAGACTTTT
TTGTATTTAAATATATGCATGTACATGTTAATGAAGCTGT
TTGTTATGTTGTTGTTTCATGAATCTTTTCATCTCGCATT
TTAAAATTGTAAATTTTAAAAGAATGATTGTTTTTAATAA
CGTCTATTTACATGTGCATTGACAAATGGTATGGTTATCT
GTAAATAATTACAATTTATTGTTCAAACGATTTTTTTAAT
AAACAAATGTACACTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations