Transcript

si:dkeyp-117h8.4-203

ID
ZDB-TSCRIPT-090929-2382
Name
si:dkeyp-117h8.4-203
Previous Names
  • si:dkeyp-117h8.4-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013003 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013003|OTTDARG00000011185|ZDB-GENE-030804-4 si:dkeyp-117h8.4|OTTDARP00000011169 DKEYP-117H8.4-002 LG_ CR352243.7 Danio rerio protein_coding NOVEL, 1774 bp
TAGGATCATGACGACAGCTCATTGACTTCTAGAATGACAC
AAGCAATAACAAGAGTAAATAAATCGATATATCTTCGTAT
TGCTTCAGCTCTGCGTGAAGTATTTCTATGTAAACAAGCC
TGTATTGTAAAGTTTCTTAACTTCTGTTTTGATACTTCAC
CATTTTCAGATGGACATGTCAGGGGTCACCGAGGATGATC
TTAACGGCTCTGGTCAACAGGAAGACAGCAAAAATCTATG
GCACGGAGCTGAATCATTCCAGCAATCAGTGAATTTAAAC
ACCACATCTCCTGGGTCTTTGTGGAGTGAGTTATCTTTGC
CTAAGGAAGAGGATGAGGAACTGGAGAAATCTTTGAGCAG
CAATGGCAGCACTCTTTTGGATGTCTATCCCAGCATGCTT
AACCAGATTGGTGAAGCATACCGGCGCCAACACTTGACTG
ATACGGCGAGATCTGTGGTACAGAAGTATCGCCGCAATCA
CTGGCAAACTGGTCCAACACAGCGCAACACATCCTTCAAA
AACAGACACGGCTGCACATTAAACAAAACAACAGATATCT
CATTCTCCAATCAAATTCAAAGTCCAGCACAAAGAAACAT
CGGTAACTGTTTCAAGGGTAGTCCAAAACTACAAAATCTA
CTCAAGAACAAACTAAAGTCTTCTCCACTCAATATATCCT
ACGAGTCCAGTGCCTGTTTTTACTCACCCAGAAGGAACAG
CGTAGATGTGAGCGGTGTGACGGATCAGTCTGCATGGATT
GATGTAGCTTTAACCAGGAAGCCGGAGCAGAATCCTGCTC
GTGTGATTGACTTCTCAACACCTTCATATTCTGGTTCCCC
TTCACATAGTGACAAATCTCCAGATCTGGACCAGACCTAT
GATGTTGAACCAACATCTCCTGCTGTTCCAACCTTATCGA
TCTTGACTTCTCCACAACAAAGCAGAGCAGGTCTGTCTAT
TACTGACCAGAGAGAAACATCAATAATCTCCCAACTCTCC
TCATTGGACAAAGACTGTTTCAGGGACCGCCTACATCCTC
CTGTTCCCTCGCCTCACCGTAGCTTCATTGGTGTCTTATC
TCCAAATGGGAAAAGCACCTTCAGACCAAGCATTCTGAAC
ATGGAAAGACAAATAAACTCGATAGGAAGTCCAAACAGAA
GGTCTTCTGTAATCCACCAAGAGCTTCTTAGATCTCCTTA
TGGTGCCAAACAGGTGCCATTTTCATCACAAAGACGACCT
GTTTATGACAACACTGATCAAACTTCCTCTAAGGTAGAGA
GTCGGTCCCATTTTACACCATTAAAACGCCAACGCTCTTT
TTCTGGCTCCCCGTCCTCATACTCATTCAGTGGATCTCAA
ATTGATGCGGAGTTCAGAAAGCTGTACCACCACTTCATCT
GCCGTGGAACATCATCACCCTGTGCTTCCTCCCATTGTCA
TCTGTGCGAAAGACACACAAAGGAGAGCTTCCAAAGCCCT
GGCTTTTCCTCCTCCAGCATGTCTGCTCTGGCTTTGACGC
CTCTGAGAGCCAAACTTAAGAAACGGAGCCGTCAGCCTGA
AGTGGAAGAGTCACTCCGGTTTAAACGCTTCAGAGAGAGT
CGCTCCCCACTGAAACATTTCCAGCTGACAGATCTTCATG
AGGACAAGCATGCTTGGGACAGAGGCGTCCTCCTGCAGTG
CCCCAGTCCAGGCTTCCTCAGGGGCACCGGAAACCTCAGA
AGAATCCGTGAGGAGAAATTGAAGATGCAGATGAACCAAC
ATGCTCTGTCTTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations