header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-130528-422
Transcript Name: smpdl3a-202
Previous Name: smpdl3a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058688 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058688|OTTDARG00000006273|ZDB-GENE-050327-61 smpdl3a|OTTDARP00000045851 smpdl3a-002 LG_ AL845421.9 Danio rerio protein_coding KNOWN, 894 bp
AATATGAGCGACCCTGCAGGGCAGTTCCAGTGGCTGCAGG
AAACACTTGAGCTGTCAAGACAAAGCATGGAGAAGGTCTA
TGTGATCGCGCACGTCCCCATCGGTTACCTACCCTTTGCT
AAAAATACGACAGCCATGCGAGAAAACTACAATGAACAAC
TGGTCAAAATATTTCGCAACTACAGTGAGGTGGTGGAGGG
TCAGTTTTATGGGCACACTCATCGGGACAGTATAATGGTT
CTTTTGGATCAGCAAGGTAAACCTGTGAACTCCATATTTG
TCACTCCTGCTGTTACACCCATCAAAAGTCAAATAGAGCC
ATTTTCAAACAACCCTGGTGTGCGTGCATATCTCTACCAA
CCTGACAGTTATACTTTGCTGGATATTTGGCAGTTCTATC
TAAATCTCACTGAAGCAAACCTGGAGCAAAGGTCCGGGTG
GAAGCTGGAATACATAATGACTGAGGCGTTTGGTATCGAT
GACATTCAGCCAGGCAGCTTGCAGGAACTCGCACTTAGTT
CATCGTCCTGCCAGAAGCCGACAATTAACGTTGACATTTT
AATTTCTGAATTCCTGCACAATGCCGGTGTTTTTTTCACT
TATAAAGTCTATTTATCTCAAGTGTCTAATTGAACTGGTC
TCTGTGTGTCTGGCCAGATGTCAACATTAGGAGCCACATG
ACCATCTGCTGTGCATTTATTATGGGTTATGCCAAGACTC
TAATGTATTGAGCCTCAAACTATGACTGTAAGCAAAAGAG
GCCTTGACATGGTTTTTTATCTTTTCAATGTGTCCCTTGT
AGTAATGTTATAATATAATGCTGTTTTTTATGATTTACAC
TACCAGTCTGAGTTCTGGAATATTTATTAAAAATGTTTTT
AAAATGTTTTAAAA

smpdl3a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA smpdl3a-201 (1) 1589
smpdl3a-202 894
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
smpdl3a-202 Contained in:

OTHER smpdl3a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058688 (1)
  • Ensembl_Trans:ENSDART00000144768 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH610064 (1) 891 bp
    CITATIONS (2)