ZFIN ID: ZDB-TSCRIPT-090929-873
Transcript Name: smpdl3a-201
Previous Names: smpdl3a-001, zgc:113352-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006911 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006911|OTTDARG00000006273|ZDB-GENE-050327-61 smpdl3a|OTTDARP00000006147 smpdl3a-001 LG_ AL845421.9 Danio rerio protein_coding KNOWN, 1589 bp
GAAGGTTGCGCAAACCAGCAGTCACGTGAGATCCGCTGTT
TTTCCTGTTTTGGTTTACACAACAAGAGTTTATAACAGTA
CCCAACTTAAACGTTCAGGAATGGCTTTATTCGTTCTGTT
ATTTTTGTTTTGTCATGTTTTTAACTTGCAGGTTTCTTCT
GCGCCAGTTAGTAATGTATTCAAACACCTGCAGACCGCAT
CTAAATTCTGGCATATCTCAGACCTGCACTTGGATCCGAC
CTACCATGTGACAGAAGACCATACCAAAGTGTGTTTTTCC
TCCAAGGGTGTTCCTGCATTGGACCCGGGAGTGTTTGGAG
ATTTCCTCTGTGATTCTCCATACCAGCTTATTCTCTCAGC
GTTCAGTTACATGAAGCAAGTGGACCTGCAGCCTGAGTTC
ATTATATGGACCGGGGACAGCCCTCCCCACGTCCCTAAAG
AAGAGCTGTCCACTGATGTAGTGATCAATGTGATTGCTAA
TATGACCCGCACCATACAGCAGTTCTTCCCACAGATTCCT
GTTTATCCTGCCCTGGGCAACCACGACTACTGGCCACAGG
ATCAGTTTCCAACATCTGAGAATGCGATTTATGATGCTGT
TGCCAAACTCTGGTCCCCATGGTTGAACCCAGCAGCTGTG
GCTACTTTGCAAAAAGGAGGCTTTTACTCTCTTGTTATCA
AACCTGGTCTGCGTCTGCTGAGTCTCAACACAAACCTGTA
CTACAGTCCTAATGAAGTGACTGTAAATATGAGCGACCCT
GCAGGGCAGTTCCAGTGGCTGCAGGAAACACTTGAGCTGT
CAAGACAAAGCATGGAGAAGGTCTATGTGATCGCGCACGT
CCCCATCGGTTACCTACCCTTTGCTAAAAATACGACAGCC
ATGCGAGAAAACTACAATGAACAACTGGTCAAAATATTTC
GCAACTACAGTGAGGTGGTGGAGGGTCAGTTTTATGGGCA
CACTCATCGGGACAGTATAATGGTTCTTTTGGATCAGCAA
GGTAAACCTGTGAACTCCATATTTGTCACTCCTGCTGTTA
CACCCATCAAAAGTCAAATAGAGCCATTTTCAAACAACCC
TGGTGTGCGTGCATATCTCTACCAACCTGACAGTTATACT
TTGCTGGATATTTGGCAGTTCTATCTAAATCTCACTGAAG
CAAACCTGGAGCAAAGGTCCGGGTGGAAGCTGGAATACAT
AATGACTGAGGCGTTTGGTATCGATGACATTCAGCCAGGC
AGCTTGCAGGAACTCGCACTTAGTTCATCGTCCTGCCAGA
AGCCGACAATTAACGTTGACATTTTAATTTCTGAATTCCT
GCACAATGCCGGTGTTTTTTTCACTTATAAAGATGTCAAC
ATTAGGAGCCACATGACCATCTGCTGTGCATTTATTATGG
GTTATGCCAAGACTCTAATGTATTGAGCCTCAAACTATGA
CTGTAAGCAAAAGAGGCCTTGACATGGTTTTTTATCTTTT
CAATGTGTCCCTTGTAGTAATGTTATAATATAATGCTGTT
TTTTATGATTTACACTACCAGTCTGAGTTCTGGAATATTT
ATTAAAAATGTTTTTAAAATGTTTTAAAA

smpdl3a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA smpdl3a-201 1589
smpdl3a-202 (1)    Ensembl 894
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
smpdl3a-201 Contained in:
[BAC] CH211-199I15 (1)

Genome Resources: Vega_Trans:OTTDART00000006911 (1),  Ensembl_Trans:ENSDART00000075096 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC091833 (1) 1660 nt
GenBank:EH592560 (1) 869 nt
GenBank:CK685497 (1) 679 nt
CITATIONS (2)