Transcript

ablim1b-208

ID
ZDB-TSCRIPT-130528-387
Name
ablim1b-208
Previous Names
  • ablim1b-008
  • dkeyp-84e12.1-008
  • si:dkeyp-84e12.1-008
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000058580 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058580|OTTDARG00000021815|ZDB-GENE-050327-91 ablim1b|OTTDARP00000045789 DKEYP-84E12.1-008 LG_none CU464184.9,CU915376.11,BX465198.11 Danio rerio protein_coding KNOWN, 261 bp
AGTGAATGGTCGCTGATGCCGAGAGTCAGAGCACACAGAG
TTGCGCACTCTCCGTTTATCTGAAAACACAGGGGATCTGG
ATTTTGGATTGAAAGTCACACTGCTGACCGTCATCATCAT
TATTAATTCTTCAGGGGAATCCGCAGCTTTTCATTCTGCA
TCATGTCAACAAGAGTGGCTCATCCTCAGGATCCACACCA
TCCTCCAGGAAAGCTGGTCATCCAGTGCTATAAATGTGGG
GAGCCATGCAAAGGAGAGGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations