Transcript

ablim1b-007

ID
ZDB-TSCRIPT-090929-10445
Name
ablim1b-007
Previous Names
  • si:dkeyp-84e12.1-007
  • zgc:112954-007
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000027907 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027907|OTTDARG00000021815|ZDB-GENE-050327-91 ablim1b|no_translation DKEYP-84E12.1-007 LG_none CU464184.9,CU915376.11,BX465198.11 Danio rerio protein_coding KNOWN, 846 bp
ATAAAATCCAATATTCAAGGAAGCCTTTTATTTGAATTTA
ATGAAGCTCACAAAACAGTTTGGATTGATAAATCTTGAAT
TGCTGCTGGAAGATTTGGCTTGTTATTTCTGACTGTCTGC
TCCTAGATCCAGCTGTGTCTCAGAAACGCTACGTCTCTCC
AGACACAAATATTTGCCAACGCAGATAAATCAAATATATT
TCCAATCAGGAATCATTACTCCATTCAATCTGATCATGTT
TTCTTGTCATTTATTATATATTATTTGTTTATATATTATT
ATTTTTTGCTTGTGTCATTTTTGTTCCATTACTAGTTTTC
CATGAGATTCTGTTGCAGGTTAGCATGGATACAAAAACAT
GGTGATGACATGGCAAACATATACATTTCTTCTCTTTCAC
TTTTTCTGGTCTCCATTTTTTTATTCTAATCAGGTTCAGA
TGGAAGGAGTCGATCACGGGATGAAGAGGAGGAAGAGCAA
CTGAAACGCAGACACCTTCAGGAAGAACACCTCAGCAAGA
TCCAGTCTGGACTTGGGAAGCTTATTCTGAAAGAGGAGAT
GGAAAAGGAGATGAACAGAGAGAGATATGTACGAAGTGTG
GCTGCCCAGCGATTTGATTCCCAGTATGCTAACTGCACCA
CAGGTATTATGCCACATACATATAAAACAAGCAAAGCATA
TATCTTTTTTATTATTGTTAATTTATTTATTATATATTTA
TTTATTTAATTACTGTTTTTACTCTGGTATAAGTACATGA
GTATATAAAAGTATTCTGTCCTTTGCTATAGACTCTCAAA
CCGTTAAAACTTCATCTCTGCCTGGGTATGGACGCAATGG
CCTCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations