Transcript

arpc5b-203

ID
ZDB-TSCRIPT-130528-365
Name
arpc5b-203
Previous Names
  • arpc5b-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058512 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058512|OTTDARG00000006186|ZDB-GENE-040120-7 arpc5b|OTTDARP00000045737 arpc5b-003 LG_ BX248238.5 Danio rerio protein_coding KNOWN, 890 bp
GCCGATAGAGGGCGCGCTATGCGGAAGTGAAGAAATCCAC
CATTGACGGCCAGACTGAGGTTGCAGGAACCGCCAGTCTC
GTTCAGCCCACTGGATTGTTAGATGGAAAGTGGACGTGGA
TGAGTACGACGAGAACAAGTTTGTGGACGAAGAAGAAGGA
GGAGAAAACCAGCTGGGTCCAGATGAGGCAGAGGTGGATT
CTCTCATCAGACAAGGGAACCTCATGGGTGCTCTACAGGC
AGTATTAAAAAACCCACCAATCAATACAAAGAATCAAAAC
GTCAAGGATCGAGCTGAAGGTCTGGTGCTGAAGGTGCTCA
GCTCCTTTAAGAGTACTGACATAGAGAAAGGAGTTCAGTC
TCTGGATAAAAATGGAGTGGACCTGCTCATGAAATACATC
TACAAGGGGTTTGAGCGGCCGTCTGAAAACAGCAGCGCCG
TTCTACTGCAGTGGCATGAAAAGGCTCTTTCTGCGGGTGG
AGTGGGCTGCATCGTGAGGGTCTTAACAGCCAGAAAAACT
GTGTAAACTGTATGCGGTTTGCACAATGCACTCAAAACAA
AAACCCAGCAGTGAAAAAACCCCTGCTGAGACACTCAGAA
CAAAGCGATGACTTTCCACAGGGTACTCAAGACGACCTCT
CATATGATTTCGATGCGTTTTCTGTCATATCACTCTTCAC
TCACTGTCAAAAACTCATAATCATGCCATCGGTTGTATGT
CATACTTACAGTAGCTTCTCTCAGGAACACTTTTCTATGC
TATTATGTATTGCATTCAGCAATCTGAATACAGTGGACTG
GTTAGAGTTTTATAAAAGCCTTGCTTAAGTTTATTATAAC
CTTTGATTACTACTACTAATTTACTTAGTGAGAAACGGCC
ATGTAACCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations