ZFIN ID: ZDB-TSCRIPT-130528-365
Transcript Name: arpc5b-203
Previous Name: arpc5b-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058512 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058512|OTTDARG00000006186|ZDB-GENE-040120-7 arpc5b|OTTDARP00000045737 arpc5b-003 LG_ BX248238.5 Danio rerio protein_coding KNOWN, 890 bp
GCCGATAGAGGGCGCGCTATGCGGAAGTGAAGAAATCCAC
CATTGACGGCCAGACTGAGGTTGCAGGAACCGCCAGTCTC
GTTCAGCCCACTGGATTGTTAGATGGAAAGTGGACGTGGA
TGAGTACGACGAGAACAAGTTTGTGGACGAAGAAGAAGGA
GGAGAAAACCAGCTGGGTCCAGATGAGGCAGAGGTGGATT
CTCTCATCAGACAAGGGAACCTCATGGGTGCTCTACAGGC
AGTATTAAAAAACCCACCAATCAATACAAAGAATCAAAAC
GTCAAGGATCGAGCTGAAGGTCTGGTGCTGAAGGTGCTCA
GCTCCTTTAAGAGTACTGACATAGAGAAAGGAGTTCAGTC
TCTGGATAAAAATGGAGTGGACCTGCTCATGAAATACATC
TACAAGGGGTTTGAGCGGCCGTCTGAAAACAGCAGCGCCG
TTCTACTGCAGTGGCATGAAAAGGCTCTTTCTGCGGGTGG
AGTGGGCTGCATCGTGAGGGTCTTAACAGCCAGAAAAACT
GTGTAAACTGTATGCGGTTTGCACAATGCACTCAAAACAA
AAACCCAGCAGTGAAAAAACCCCTGCTGAGACACTCAGAA
CAAAGCGATGACTTTCCACAGGGTACTCAAGACGACCTCT
CATATGATTTCGATGCGTTTTCTGTCATATCACTCTTCAC
TCACTGTCAAAAACTCATAATCATGCCATCGGTTGTATGT
CATACTTACAGTAGCTTCTCTCAGGAACACTTTTCTATGC
TATTATGTATTGCATTCAGCAATCTGAATACAGTGGACTG
GTTAGAGTTTTATAAAAGCCTTGCTTAAGTTTATTATAAC
CTTTGATTACTACTACTAATTTACTTAGTGAGAAACGGCC
ATGTAACCTC

arpc5b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA arpc5b-202 (1)    Ensembl 1630
arpc5b-203 890
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arpc5b-203 Contained in:
[BAC] CH211-169J21 (1)

Genome Resources: Vega_Trans:OTTDART00000058512 (1),  Ensembl_Trans:ENSDART00000152870 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN177689 (1) 853 nt
GenBank:CN315738 (1) 836 nt
GenBank:EH564405 (1) 310 nt
CITATIONS (2)