ZFIN ID: ZDB-TSCRIPT-090929-840
Transcript Name: arpc5b-202
Previous Name: arpc5b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006797 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006797|OTTDARG00000006186|ZDB-GENE-040120-7 arpc5b|OTTDARP00000006050 arpc5b-001 LG_ BX248238.5 Danio rerio protein_coding KNOWN, 1630 bp
CTATGCGGAAGTGAAGAAATCCACCATTGACGGCCAGACT
GAGGTTGCAGGAACCGCCAGTCTCGTTCAGCCCACTGGAT
TGTTAGATGGTATTGATGCAAAAGCGCTTAGTTTAACTTC
AAACGGGGGAATCATTTACCATCATCATGTCAAAGAACAC
GGTGTCCGATCGTTTCAGGAAAGTGGACGTGGATGAGTAC
GACGAGAACAAGTTTGTGGACGAAGAAGAAGGAGGAGAAA
ACCAGCTGGGTCCAGATGAGGCAGAGGTGGATTCTCTCAT
CAGACAAGGGAACCTCATGGGTGCTCTACAGGCAGTATTA
AAAAACCCACCAATCAATACAAAGAATCAAAACGTCAAGG
ATCGAGCTGAAGGTCTGGTGCTGAAGGTGCTCAGCTCCTT
TAAGAGTACTGACATAGAGAAAGGAGTTCAGTCTCTGGAT
AAAAATGGAGTGGACCTGCTCATGAAATACATCTACAAGG
GGTTTGAGCGGCCGTCTGAAAACAGCAGCGCCGTTCTACT
GCAGTGGCATGAAAAGGCTCTTTCTGCGGGTGGAGTGGGC
TGCATCGTGAGGGTCTTAACAGCCAGAAAAACTGTGTAAA
CTGTATGCGGTTTGCACAATGCACTCAAAACAAAAACCCA
GCAGTGAAAAAACCCCTGCTGAGACACTCAGAACAAAGCG
ATGACTTTCCACAGGGTACTCAAGACGACCTCTCATATGA
TTTCGATGCGTTTTCTGTCATATCACTCTTCACTCACTGT
CAAAAACTCATAATCATGCCATCGGTTGTATGTCATACTT
ACAGTAGCTTCTCTCAGGAACACTTTTCTATGCTATTATG
TATTGCATTCAGCAATCTGAATACAGTGGACTGGTTAGAG
TTTTATAAAAGCCTTGCTTAAGTTTATTATAACCTTTGAT
TACTACTACTAATTTACTTAGTGAGAAACGGCCATGTAAC
CTCAGTTATTTCATTCTGCATCATGTGTGAATGGCTTGAA
ATGAACAGCCACACAGGGTGGTGGGTTTAACTGGCACCAC
GTCTGTCCGCATCAACAGTCGGATTATGAATAATACTCTC
TGGTGCATTAAACCTTCCCATCACTGATCCCTTCTTGTTT
GTTCTAAATCGCAGGACTTTATGCCATAGTAGTATTTTTT
TTTCCATAGCCAAAGCGCATTATCTCCTATACTCATATAA
GTCACATCTCCGATCTTACTGTACTGTGCTTCATCTGAAA
CAGCTGTTTGATTTCTTGGCTAATCGTGACTTTCACTAAT
GCTGTTATAAAGTATTAATGTCCTGTCTTAATGTATCTGT
GTCAGCATTCCAAAGCACTTAATGCCGTGGACCATTGCTA
TTGTATGTGTGTCCGAATGTATACGTCTGTATGGATGCGT
TTGGAAGCCAATCATGTTGAATACTATTACTGCCTCAAAG
CAGATCAGCATTGATCCAGTCTAATCTGAGACGTAATGTC
TGATCACAGGGACCTGCCTTCACAATGCAGTAATACAGAA
CGCAAACACTCAATAATAAACCAAACCGGTATGATGACTG
CCTTACAAAAATATTCCTTTTTTTATGTTTGTGCTTTTGT
GATCGAATAATAAAATATTCAATATATATA

arpc5b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA arpc5b-202 1630
arpc5b-203 (1)    Ensembl 890
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arpc5b-202 Contained in:
[BAC] CH211-169J21 (1)

Genome Resources: Vega_Trans:OTTDART00000006797 (1),  Ensembl_Trans:ENSDART00000145852 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC049407 (1) 1705 nt
GenBank:AY394953 (1) 1653 nt
GenBank:BM890460 (1) 647 nt
CITATIONS (2)