ZFIN ID: ZDB-TSCRIPT-130528-176
Transcript Name: vti1a-202
Previous Name: vti1a-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058712 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058712|OTTDARG00000021817|ZDB-GENE-050809-135 vti1a|OTTDARP00000045864 vti1a-003 LG_none CR456684.10,CU459010.7,CU459116.4,CU459185.9 Danio rerio protein_coding KNOWN, 739 bp
CTCTTTTAATCTTTTAAAACTAAAAATACAACATGTCTTC
AGATTTTGAAGCGTACGAACAGGACTTTGGGACCCTCACC
GCTGAAATAACCAACAAAATCGGACGAATACCCAAATTAG
CCGGTGAGGAGAAGACACAGCTGGTTCTAAATGTCGACAA
ACAGCTTGAAGAAGTCAGAGAGTTGATGGAGCAGATGGAC
CTGGAGGTTCGAGAGATCCCTATTCAGAGCCGAGCCATGT
ACAACAGCCGTCTGAAGAGCTACAAGCAAGAGATGGAGAA
ACTTGAGAAAGATTTTAAAAGGTCACGTATTGCCTACAGT
GATGAGGTGCGGAACGAGCTCCTGGGGGATGATGGGAGCT
CCTCCGAGACTCAGAGAGCACATCTGTTGGACAACACAGA
GAGGCTGGAAAGGTCATCTCGGAGGCTGGAAGCTGGCTAC
CAGATAGCAGTGGAAACCGGAGCACATCAAAGAGAAGCAA
CGGAGAGAGAGGTGTAGAGCAGCAGCCGCAGTACTGTTCA
GCTCACACAAAACACACCGCCTGATTTCCATTCACCTACC
TGTGTGTGTGTCTGAGAGAGAGAGAGAGAGAGAGTTTTTA
TTATGGGTACCAAATGATGGCGTGTCGACTAGAATAAACA
ACAACAACAGCCTGCCTGTAACGTCCTGCAACATTTCGAG
CTAAATAAAGACCAAGATCTTTTAATAAACCCATTTCTAA
ATAAAGCCCTCGATTCGCA

vti1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA vti1a-201 (1)    Ensembl 757
vti1a-202 739
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vti1a-202 Contained in:
[Fosmid] CH1073-103H6 (1)

Genome Resources: Vega_Trans:OTTDART00000058712 (1),  Ensembl_Trans:ENSDART00000153172 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EX154721 (1) 700 nt
GenBank:CO360456 (1) 274 nt
CITATIONS (2)