Transcript

vti1a-202

ID
ZDB-TSCRIPT-130528-176
Name
vti1a-202
Previous Names
  • vti1a-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058712 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058712|OTTDARG00000021817|ZDB-GENE-050809-135 vti1a|OTTDARP00000045864 vti1a-003 LG_none CR456684.10,CU459010.7,CU459116.4,CU459185.9 Danio rerio protein_coding KNOWN, 739 bp
CTCTTTTAATCTTTTAAAACTAAAAATACAACATGTCTTC
AGATTTTGAAGCGTACGAACAGGACTTTGGGACCCTCACC
GCTGAAATAACCAACAAAATCGGACGAATACCCAAATTAG
CCGGTGAGGAGAAGACACAGCTGGTTCTAAATGTCGACAA
ACAGCTTGAAGAAGTCAGAGAGTTGATGGAGCAGATGGAC
CTGGAGGTTCGAGAGATCCCTATTCAGAGCCGAGCCATGT
ACAACAGCCGTCTGAAGAGCTACAAGCAAGAGATGGAGAA
ACTTGAGAAAGATTTTAAAAGGTCACGTATTGCCTACAGT
GATGAGGTGCGGAACGAGCTCCTGGGGGATGATGGGAGCT
CCTCCGAGACTCAGAGAGCACATCTGTTGGACAACACAGA
GAGGCTGGAAAGGTCATCTCGGAGGCTGGAAGCTGGCTAC
CAGATAGCAGTGGAAACCGGAGCACATCAAAGAGAAGCAA
CGGAGAGAGAGGTGTAGAGCAGCAGCCGCAGTACTGTTCA
GCTCACACAAAACACACCGCCTGATTTCCATTCACCTACC
TGTGTGTGTGTCTGAGAGAGAGAGAGAGAGAGAGTTTTTA
TTATGGGTACCAAATGATGGCGTGTCGACTAGAATAAACA
ACAACAACAGCCTGCCTGTAACGTCCTGCAACATTTCGAG
CTAAATAAAGACCAAGATCTTTTAATAAACCCATTTCTAA
ATAAAGCCCTCGATTCGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations