ZFIN ID: ZDB-TSCRIPT-090929-10446
Transcript Name: vti1a-201
Previous Name: vti1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027909 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027909|OTTDARG00000021817|ZDB-GENE-050809-135 vti1a|OTTDARP00000022842 vti1a-001 LG_none CR456684.10,CU459010.7,CU459116.4,CU459185.9 Danio rerio protein_coding KNOWN, 757 bp
ACCCGGAAGTGACGCGGACGTCAATAAGAAGCAGACACAA
GCAACAGTGTGTAACGCAGCTCAGTTTATCGCTCTTTTAA
TCTTTTAAAACTAAAAATACAACATGTCTTCAGATTTTGA
AGCGTACGAACAGGACTTTGGGACCCTCACCGCTGAAATA
ACCAACAAAATCGGACGAATACCCAAATTAGCCGGTGAGG
AGAAGACACAGCTGGTTCTAAATGTCGACAAACAGCTTGA
AGAAGTCAGAGAGTTGATGGAGCAGATGGACCTGGAGGTT
CGAGAGATCCCTATTCAGAGCCGAGCCATGTACAACAGCC
GTCTGAAGAGCTACAAGCAAGAGATGGAGAAACTTGAGAA
AGATTTTAAAAGGTCACGTATTGCCTACAGTGATGAGGTG
CGGAACGAGCTCCTGGGGGATGATGGGAGCTCCTCCGAGA
CTCAGAGAGCACATCTGTTGGACAACACAGAGAGGCTGGA
AAGGTCATCTCGGAGGCTGGAAGCTGGCTACCAGATAGCA
GTGGAAACCGAGCAAGTTGGACAGGAGATCCTCGCCAACC
TGCACAGCGATCGTGAGAAGATTCAGAGATCCCGTGATCG
GCTGAGAGAGACGGACGCTAACCTGGGCAAGAGCTCTCGG
ATCCTGACCGGCATGCTGAGAAGGATCATTCAGAACCGCA
TCCTGGTCTTCATCCTGGGCGCCATCATCCTCCTCACCAT
CGTCTTGGCCATCTATTTTAATTTGCGAGGGCACTGA

vti1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA vti1a-201 757
vti1a-202 (1)    Ensembl 739
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vti1a-201 Contained in:
[Fosmid] CH1073-103H6 (1)

Genome Resources: Vega_Trans:OTTDART00000027909 (1),  Ensembl_Trans:ENSDART00000066256 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK400010 (1) 867 nt
GenBank:EB776855 (1) 546 nt
CITATIONS (2)