Transcript

vti1a-201

ID
ZDB-TSCRIPT-090929-10446
Name
vti1a-201
Previous Names
  • vti1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027909 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027909|OTTDARG00000021817|ZDB-GENE-050809-135 vti1a|OTTDARP00000022842 vti1a-001 LG_none CR456684.10,CU459010.7,CU459116.4,CU459185.9 Danio rerio protein_coding KNOWN, 757 bp
ACCCGGAAGTGACGCGGACGTCAATAAGAAGCAGACACAA
GCAACAGTGTGTAACGCAGCTCAGTTTATCGCTCTTTTAA
TCTTTTAAAACTAAAAATACAACATGTCTTCAGATTTTGA
AGCGTACGAACAGGACTTTGGGACCCTCACCGCTGAAATA
ACCAACAAAATCGGACGAATACCCAAATTAGCCGGTGAGG
AGAAGACACAGCTGGTTCTAAATGTCGACAAACAGCTTGA
AGAAGTCAGAGAGTTGATGGAGCAGATGGACCTGGAGGTT
CGAGAGATCCCTATTCAGAGCCGAGCCATGTACAACAGCC
GTCTGAAGAGCTACAAGCAAGAGATGGAGAAACTTGAGAA
AGATTTTAAAAGGTCACGTATTGCCTACAGTGATGAGGTG
CGGAACGAGCTCCTGGGGGATGATGGGAGCTCCTCCGAGA
CTCAGAGAGCACATCTGTTGGACAACACAGAGAGGCTGGA
AAGGTCATCTCGGAGGCTGGAAGCTGGCTACCAGATAGCA
GTGGAAACCGAGCAAGTTGGACAGGAGATCCTCGCCAACC
TGCACAGCGATCGTGAGAAGATTCAGAGATCCCGTGATCG
GCTGAGAGAGACGGACGCTAACCTGGGCAAGAGCTCTCGG
ATCCTGACCGGCATGCTGAGAAGGATCATTCAGAACCGCA
TCCTGGTCTTCATCCTGGGCGCCATCATCCTCCTCACCAT
CGTCTTGGCCATCTATTTTAATTTGCGAGGGCACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations