Transcript

cx43-203

ID
ZDB-TSCRIPT-130528-170
Name
cx43-203
Previous Names
  • cx43-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058693 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058693|OTTDARG00000007101|ZDB-GENE-991105-4 cx43|OTTDARP00000045852 cx43-003 LG_ CR352322.5 Danio rerio protein_coding NOVEL, 913 bp
CTTCAGTTTCTCCATAGTCGCGTACTTGGATTTGGTGACT
GAACTTCAGAGGCGACGGAGTAAGTCCCTACAGGGCTCTC
CACTCTTTACTTCTTTCCAGCTAGAACTCCCTCAAGATGG
GTGACTGGAGTGCGTTGGGAAGGCTTCTTGACAAGGTGCA
GGCCTACTCCACGGCCGGAGGGAAGGTCTGGCTCTCTGTG
CTCTTCATCTTCCGGATCCTTGTTCTGGGAACAGCAGTGG
AATCGGCCTGGGGTGACGAGCAGTCAGCTTTCAAGTGCAA
TACCCAGCAGCCTGGTTGCGAGAATGTCTGCTATGACAAA
TCGTTCCCCATCTCGCACGTGCGCTTCTGGGTGCTTCAGA
TCATCTTCGTGTCCACGCCGACGCTCCTGTACCTGGCGCA
TGTCTTCTACCTGATGCGAAAGGAGGAGAAACTCAACCCC
TCTCTGCCGTGTACACATGCGAACGCACGCCTTGCCCTCA
TAGGGTGGACTGTTTCCTTTCTCGGCCCACCGAGAAGACC
ATCTTCATCATCTTCATGCTAGTGGTTTCGCTCTTCTCGC
TTTTGCTCAACATCATCGAGCTCTTCTACGTGCTCTTCAA
ACGAATCAAGGACCGCGTCAAAAGCCGACAAAACACACAG
TTTCCCACTGGCACTTTGAGCCCCACGCCGAAGGAACTGT
CTACGACCAAATACGCGTACTACAATGGTTGCTCCTCACC
AACTGCACCGCTCTCACCAATGTCACCTCCAGGCTACAAA
CTGGCCACCGGCGAAAGGACCAACTCTTGCCGCAATTACA
ACAAGCAGGCTAATGAGCAGAATTGGGCCAACTACAGCAC
AGAACAGAATCGCTTGGGCCAGAATGGCAGCACCATCTCC
AATTCACATGCACAAGCCTTCGACTACCCTGAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations