Transcript

cx43-201

ID
ZDB-TSCRIPT-090929-1120
Name
cx43-201
Previous Names
  • cx43-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007989 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007989|OTTDARG00000007101|ZDB-GENE-991105-4 cx43|OTTDARP00000007061 cx43-001 LG_ CR352322.5 Danio rerio protein_coding NOVEL, 2917 bp
GCGTCTGCTTTCCACTTTCTTCCCTCTGACTCTCTTATAA
GCAGGGAAAGTTTGACAAGTGTGCTTCAGTTTCTCCATAG
TCGCGTACTTGGATTTGGTGACTGAACTTCAGAGGCGACG
GAGTAAGTCCCTACAGGGCTCTCCACTCTTTACTTCTTTC
CAGCTAGAACTCCCTCAAGATGGGTGACTGGAGTGCGTTG
GGAAGGCTTCTTGACAAGGTGCAGGCCTACTCCACGGCCG
GAGGGAAGGTCTGGCTCTCTGTGCTCTTCATCTTCCGGAT
CCTTGTTCTGGGAACAGCAGTGGAATCGGCCTGGGGTGAC
GAGCAGTCAGCTTTCAAGTGCAATACCCAGCAGCCTGGTT
GCGAGAATGTCTGCTATGACAAATCGTTCCCCATCTCGCA
CGTGCGCTTCTGGGTGCTTCAGATCATCTTCGTGTCCACG
CCGACGCTCCTGTACCTGGCGCATGTCTTCTACCTGATGC
GAAAGGAGGAGAAACTCAACCGTAAAGAAGAGGAGCTGAA
GGCCGTGCAGAACGACGGCGGCGACGTTGAGCTCCATCTC
AAGAAAATCGAGCTCAAGAAGTTTAAGCATGGCCTAGAGG
AGCACGGCAAGGTGAAGATGAAGGGTAGCCTGCTGCGCAC
CTACATCTTCAGCATCATTTTCAAGTCCATCTGTGAGGTG
GTCTTCCTGGTCATCCAATGGTACCTCTACGGCTTCAGCC
TCTCTGCCGTGTACACATGCGAACGCACGCCTTGCCCTCA
TAGGGTGGACTGTTTCCTTTCTCGGCCCACCGAGAAGACC
ATCTTCATCATCTTCATGCTAGTGGTTTCGCTCTTCTCGC
TTTTGCTCAACATCATCGAGCTCTTCTACGTGCTCTTCAA
ACGAATCAAGGACCGCGTCAAAAGCCGACAAAACACACAG
TTTCCCACTGGCACTTTGAGCCCCACGCCGAAGGAACTGT
CTACGACCAAATACGCGTACTACAATGGTTGCTCCTCACC
AACTGCACCGCTCTCACCAATGTCACCTCCAGGCTACAAA
CTGGCCACCGGCGAAAGGACCAACTCTTGCCGCAATTACA
ACAAGCAGGCTAATGAGCAGAATTGGGCCAACTACAGCAC
AGAACAGAATCGCTTGGGCCAGAATGGCAGCACCATCTCC
AATTCACATGCACAAGCCTTCGACTACCCTGATGATACAC
ATGAGCACAAGAAACTGACGCCAGGGCATGAGTTGCAGCC
ATTGGCGTTGATAGATGCACGGCCGTGCAGCCGTGCCAGC
AGCCGCATGAGCAGTCGAGCGAGGCCTGATGACCTGGACG
TCTAGCCATGCCACATCCCAACGCTAGAGGACTGACACAG
GCAATGAGACATGCTCATCTCCTGTAACGAGGAGGCGAGG
CTGAATCCTCGCAAGTTCCTCACTCTAGACTCTAGTCGAT
ACAGAGACATAAAATTACTCACACTGCTGGAGGTACTATT
CATTAACAATGATGTTGAAACTAGCAGAGCTAACATGCCC
TAACTACCGAACAGTCAAGGGGGCTCGTCCGGGACGAACG
GCACTGAACTTGCCACGTCTCTCAACTCAGCCCACCAGAA
CAGACCTTGGCGATGTGATTGATTTTTGTTGTGCTTGTTG
AAATGCCACACAATGATTCCACTTTAACACTTTGCACTCC
TACAGTTTGTGTAGATTTGTGTTCTAACCCCCCCTACAGT
CGATCCCGGTTATAACGTCAATCGTTCGCATGATCTCAAA
TCCAACAGGGTGTTCACAGTCATGAATTAATATTTATTTA
TTCATAAAGATTAACATGATATCCACCACTAGATAAAGAT
TGACTACTACTCAAGGTCATGTCTACACAATTAATACCAT
CCAAGTGCATATTTATTGACAATAATCCAAATTCCAGCAA
TACGTTCATCAGCAAATGTGTTTTTTTTTTTTTTTGTTAT
TAATCACAGTGGACTGTCATTTTCCTGATAAACTTTGAAT
TTATGTGGTGTTGGTTTTTGTTATTCGATGATATTTGTTG
TATTTTGGGTGGTGGTATGAAACGGAAATGTCTTATATGT
GGACTGAGCTGCTGTAACTTACACGGCTTGATTCTTTCTT
TTTTCTGCATCTTGATTTTTACTGAATAGTATGAGAGAGA
AAGGCTTTATTTTTGTTCTCTTTTTTATTTCTTATTTTCC
TTTATTTTTGGAGGGCAGACAGAATGATTTAGTTTTTTTT
TTTATTAGAATGAATAGAAATTAACGTCTTACCTTTGGAG
TGAATGACCTTTTTAACTCAATGTAATCGTTGCTGCTTGA
GAGATAGAGACTTAGTACTGTAAATCAAGCTAATGTCACA
AATGTGAGGTTTTTTTAGAAGACTGCTTTTTTAGAGCTGG
ACTAATATTTAGTCAGTTATATTAAGAGATATATGCCAGC
GTAGCTCCACAACTACCAAACACTAGTAGATGAAATTTCA
TTATGGACATTCCTTGTTTTGATTCTTCAAATTGTGCATC
ATAGTATATTGGTACTCATTTGCAGAGGCTCATGGATTTT
TCAGCTACAATGGTGTTTGCACTGAGATTTTGGCTAGGGT
GTTATTTGATGCAAAAAAATGACGAAAAGTTCTCTGTTAT
GCACGTAACTAATTTATTTTACATCACACTACGAGGCGTA
AAAATCACTACACTTTAACAGTGCTCTCACATAATCCTTG
GGTTTGAGATGTTGAGTGGCTAAGGCAAGATTGTGCATCT
GGTGAATAGTGCAAATTTGGGTTTAAACTGATGTAATGGG
AATCCGCTGTCGTACCGTGTGCATGACAGTGGAAAAACCG
AGCAATCACAAACAAAAACGGACATTAATCAAATCTGTGA
AAAAGCAATTTAACCAATAAAGATTTTTTCTTTGTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations