Transcript

kif22-202

ID
ZDB-TSCRIPT-121213-808
Name
kif22-202
Previous Names
  • kif22-001
  • ch211-149k17.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057554 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057554|OTTDARG00000040116|ZDB-GENE-080204-34 kif22|OTTDARP00000045095 CH211-149K17.6-001 LG_ AL929469.10 Danio rerio protein_coding KNOWN, 2287 bp
GTCAAGGAGTTTATACGGAAGTAGTGATGCATTGAATTGA
GTAATTTTTAAAAAACACACTCACATTGTACCCGAGTGTG
AATTATATATCGTTCAAGAACTGGATTAGCCGCTGCACAA
GTGAAGAGAAATGGCACAGCGTGTTGCTGTGAACGATGGA
GCTGCTGGATCCAAACGCACCTCTCGTGTTCGAGTGGCCG
TCCGGCTGAGACCCTACATGGACAAGCAGGACGAGAAGAG
CGAGGGCTCCTGTGTGCGGGGTCTGGGGCCACAGAAGCTG
GAGATCATCAACTGGAGGAACGCCACTGAGACCCTGCAGT
ACCAGTTTGATGTGTTTCATGGTGAAGAGACCACACAGCA
GGAGGTGTTTCTGACCTCCGTCAAGCCAATCCTCCCACAC
ATCCTCAATGGTCAGAATGCCAGTGTCTTTGCCTACGGAC
CCACCGGAGCAGGAAAGACCCACACCATGCTGGGCAGTCA
AGAGCAGCCAGGCGTTATTCCCAGAGCTGTAAAGGAGGTC
TTCAATCTGGTTGGAGCTCAGAAAAAAGAGCAAGATGGTT
GGGAGTACTCCATTGGGATGTCTTACTTGGAAATCTACAA
TGAAAAGGTGCTGGATCTGTTGTCCCCAGGTTCCCAGGAC
CTGCCCATCCGTGAAGACAAGGACAGAAACATCCTCATTC
CCGGGTTAACACACACTCCTCTCTCATCTTTTGCTGATTT
TGACACTCATTTCATCCCCGCGAGCCTCAACCGAACCACA
GCCTCTACTAAACTCAACCAGCGCTCCAGCCGCAGTCACG
CCATCCTCCTCATAAAGGTGGTGAAGTCTCAGCGTGGTCC
GCCACACAGACAGCAAACAGGAAAGCTTTATTTGGTGGAT
CTTGCCGGTTCAGAGGACAATCGGCGCACAGGAAACCAGG
GCATTCGTCTGAAAGAGAGCGGAGCCATCAACTTGTCTCT
GTTCACGCTCAGTAAGGTGGTGGACGCTCTGAACACAGGG
GCTGGGGGCCGCGTGCCCTACAGAGACAGTAAACTCACCC
GCCTGCTGCAGGACTCTTTGGGTGGATCCGCACATTCTGT
CATGATCACAAACATCGCACCCGAGTACAAATACTACTTT
GACACCTTTTCTGCACTTAATTTCGCCGCAAAGTCTAAGC
AGATTGTCAATCGGCCTTTTGTCAGAGAAACTGTTTTGGC
CCCTACGATTGCTCCTGGAAAGAGAACCAGAGAGGAACAG
GAGGCTGGAGGTTCTGGTGAACCCCAGAACAAGAGATCCA
AAGAAGGGAAGAAAGCTGAACATTCCCCATCACCGCCCTT
ACATCCACAGAGTTCACCAGATTCATCAGTTCTGGACCGA
CTCCTGGCTCTGGAGAAGATGATGATGGGCTCAGCTGAGA
GGGAGAGACTCAACCTGCTCAAAACTGTTGCACAGTCCCG
AAAAGAAATCCAGATGTTGAAGGAGAAACAGAAGGAGCTG
GAGGACAAAGCCAACATGTTTAATAAGCAGAAAGAAACCA
CTGAGAAAGAGTCCAAAGATGCTCTTCTTTTCAAGACCGA
TCTGCCGCCCCTACACAGAAAACAGTCGACAGCCGCCAAA
CCACGCAAACAGCAGGCCGTTGTTACTCCATTACAGGTGT
CTCAGGTGCAGCCCTTACAGCAGTGTGCAGTGGTCTGCAA
ACCCTCACAGACCTTGGTTAAGAAGAAACGTGTCCAAACG
GAGGTGTGTGATGGAAAGGAAAACATAGGTGTGGATCTTC
ATCCTGTTGAAGATGTCAACTGGGAGTCCCGTCTGGATCC
AGCATTACTGGAACAGTCCAGGAAGAAGATCCTGCAGACG
CTCAACTCGGGCTCTCTGAAGGAGCTCAAGAGCCTGCAGC
AGATCGGAGACAAGAAGGCCAAACTCATCATGGGATGGAG
AGAGATTAATGGAGACTTCACACAGGTGGAAGACCTGAAG
AAAATCGAAGGTGTTACAGTTAAACGATTCTCTTCTTTCA
TAAAGGCCAATATTCTCAGCAGTATGGGAAAGTGAAGCAA
TTTGAGCTGCTGTGACTGAAGAGGAGAGCCTGCATACTTG
TTTTTACATGTGTTTTATGGATATAATGTGTACAGTTTTT
AAACTTTTTTTTTTCTTTGTGTATACTTGACTGCTGTTTT
TCTTGTTTTCATTTTTCAGTGAATTTCCTGCATACCTAGG
CCAATTTTTTCTTTTATTTAACTTTTTAATCTGTAAATGA
ACCTGTTTCATTTCATAAAGGCACTAAATAAATGCCATCA
TCACATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations