Transcript

kif22-201

ID
ZDB-TSCRIPT-121213-187
Name
kif22-201
Previous Names
  • kif22-002
  • ch211-149k17.6-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057555 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057555|OTTDARG00000040116|ZDB-GENE-080204-34 kif22|OTTDARP00000045096 CH211-149K17.6-002 LG_ AL929469.10 Danio rerio protein_coding KNOWN, 745 bp
AATAACCGTGCCGACCCGAGAGGCGCCATTGTCAAGGAGT
TTATACGGAAGTAGTGATGCATTGAATTGAGTAATTTTTA
AAAAACACACTCACATTGTACCCGAGTGTGAATTATATAT
CGTTCAAGAACTGGATTAGCCGCTGCACAAGTGAAGAGGT
TTGATGTGTTTCATGGTGAAGAGACCACACAGCAGGAGGT
GTTTCTGACCTCCGTCAAGCCAATCCTCCCACACATCCTC
AATGGTCAGAATGCCAGTGTCTTTGCCTACGGACCCACCG
GAGCAGGAAAGACCCACACCATGCTGGGCAGTCAAGAGCA
GCCAGGCGTTATTCCCAGAGCTGTAAAGGAGGTCTTCAAT
CTGGTTGGAGCTCAGAAAAAAGAGCAAGATGGTTGGGAGT
ACTCCATTGGGATGTCTTACTTGGAAATCTACAATGAAAA
GGTGCTGGATCTGTTGTCCCCAGGTTCCCAGGACCTGCCC
ATCCGTGAAGACAAGGACAGAAACATCCTCATTCCCGGGT
TAACACACACTCCTCTCTCATCTTTTGCTGATTTTGACAC
TCATTTCATCCCCGCGAGCCTCAACCGAACCACAGCCTCT
ACTAAACTCAACCAGCGCTCCAGCCGCAGTCACGCCATCC
TCCTCATAAAGGTGGTGAAGTCTCAGCGTGGTCCGCCACA
CAGACAGCAAACAGGAAAGCTTTATTTGGTGGATCTTGCC
GGTTCAGAGGACAATCGGCGCACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations