header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-805
Transcript Name: myo1cb-202
Previous Name: myo1cb-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057505 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057505|OTTDARG00000040089|ZDB-GENE-090429-3 myo1cb|OTTDARP00000045064 myo1c-002 LG_none CR522882.5,CR478288.14 Danio rerio protein_coding NOVEL, 679 bp
GGCGAGAGGAAGCCCTGACGGCAGACTCTCAGGGCAGCTC
AGTGTCCGGATACTTTCATTACAGACCAGACCTGGACACC
ATTTACACATCTAACAGCCTAAACAGACTCTCTTTTTGGC
AAGGGAGCAGAAGCTGCAGTGAGGCGGATTGAAGCGCCTC
TTCATTCACAGGCTGCTAGTGAGGAACGCCACTCGTACTA
AGTCAAAGAAACACATCATGATGGAGCTGAAGATCCAGCT
CATTCCCACAGGAGAAATCATTCTGCCTCCTGGGAAAAAT
GGAGAGTTTTACTGCCAAAGCTGCACAAAGGCTGTGGGCA
GTGACGGAATCCGGGTCATGATGGAGAGTGCCCTGACAGC
CAGGGACCGGGTGGGTGTGCAGGATTTTGTCCTGCTGGAG
AACCACACCAGCGAGGTGGCGTTCATTGAGAACCTCCGCA
AACGCTTCAAGGAGAACCTCATTTATACATACATCGGTTC
AGTGCTGGTGTCTGTAAATCCCTACAAAGATTTGGAGATC
TACACTAAACAGCACATGGAGAGATACAGGGGTGTCAATT
TCTATGAAGTGTCGCCTCACATTTATGCAGTGGCTGATAA
TGCATATCGCTCCATGCGGACTGAGAGACGGGACCAGTGC
ATCCTCATCTCGGGTGAAAGCGGTGCCGGCAAGACTGAA

myo1cb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA myo1cb-202 679
myo1cb-203 (1) 6430
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myo1cb-202 Contained in:

OTHER myo1cb-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000057505 (1)
  • Ensembl_Trans:ENSDART00000152536 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB890409 (1) 690 bp
    CITATIONS (2)