header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-184
Transcript Name: myo1cb-203
Previous Name: myo1cb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057506 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057506|OTTDARG00000040089|ZDB-GENE-090429-3 myo1cb|OTTDARP00000045065 myo1c-001 LG_none CR522882.5,CR478288.14 Danio rerio protein_coding NOVEL, 6430 bp
TTCCTGGTCGAGTGAAAGAGAGAGGGGGAGAGAGAGAGGG
CGGCTGCCGGGTTGGTAGTGGTAATATATCTCTAACACTC
GCTTCAAGCCAGTTCTGAGAGAATGTCCTTTGGCATGACG
TTAGTTACTTCAACTAGAGCATGACTCTGTGTTTATTTAC
ACTTAAATCTCCTGTAGTCTACATCTGCCAACACGACGTA
AAAGCGGATTTTTAGTGCCATACAGGGGTACATATTAAGG
TCGGTGGGATTCACACAGGAGAGAAAAGTGCAATTACAGC
TGAAGTGAGAGAAGAAGTTTCCCATCACCGCCGAGTGTCT
CTTATGCAGTATTACGGTTGTTTTGGACGTTGCGGGGTTT
GAAGTTGGCGTGCTTTAATCAAGGCTGTGGGCAGTGACGG
AATCCGGGTCATGATGGAGAGTGCCCTGACAGCCAGGGAC
CGGGTGGGTGTGCAGGATTTTGTCCTGCTGGAGAACCACA
CCAGCGAGGTGGCGTTCATTGAGAACCTCCGCAAACGCTT
CAAGGAGAACCTCATTTATACATACATCGGTTCAGTGCTG
GTGTCTGTAAATCCCTACAAAGATTTGGAGATCTACACTA
AACAGCACATGGAGAGATACAGGGGTGTCAATTTCTATGA
AGTGTCGCCTCACATTTATGCAGTGGCTGATAATGCATAT
CGCTCCATGCGGACTGAGAGACGGGACCAGTGCATCCTCA
TCTCGGGTGAAAGCGGTGCCGGCAAGACTGAAGCTTCCAA
GAAGGTTCTTCAGTACTACGCTGTCACCTGTCCTGCCAGT
GATCACGTGCAGACTGTCAAAGATCGCTTGCTACAATCCA
ACCCTGTGCTGGAGGCCTTTGGAAATGCAAAAACTTTAAG
AAATGACAATTCCAGTCGCTTTGGGAAATACATGGACATT
CAGTTTGACTTCAAGGGTGCTCCAGTCGGCGGTCACATCC
TGAACTACCTGCTAGAGAAATCCCGCGTCGTGCACCAAAG
CAACGGCGAGAGGAACTTCCATATCTTTTATCAGCTCATC
GAAGGAGGAGAGGACGATCTGCTTAGGAGACTAGGCCTGG
AGAGAAACGCCCAACAGTACCAGTATCTGGTCAAGGGTAA
CTGTCCTAAAGTGAGCTCAATTAATGACCGCAATGACTGG
AAGACAGTGAGGAAAGCCTTGAGCGTCATCGGCTTCACTG
ATGATGAAGTGGAGGAGCTTTTGAACATTATTGCCAGTGT
GCTACACTTGGGGAATGTCCAGTATGGAGGAGAGGACAGC
GGCAGTGCCTACATCACTACAGACACACAGATTAAATACT
TAGCCAGGTTGTTAGGCGTGGATGGCACAGTTCTTAAAGA
GGCTCTAACACATAAAAAGATTATTGCCAAAGGAGAAGAG
CTGATGAGTCCTTTAAATCAAGAGCAGGCCGCTTCGGCGC
GGGATGCTTTATCTAAAGCCATATACGGGCGGACTTTTTC
TTGGCTGGTCAACAAAATTAACGACTCTCTGGCCTTCAAG
GATGAGTCATTTAGCAGTAAGAACGCTTCTGTCATTGGCC
TGCTGGACATCTATGGTTTTGAGGTCTTTCAGAACAACAG
TTTTGAGCAGTTTTGCATCAACTATTGTAATGAGAAGCTG
CAGCAGCTCTTCATTGAACTGACCCTGAAGTCAGAGCAGG
AGGAATATGAAGCTGAGGGAATCACGTGGGAGCCTGTGCA
ATATTTTAACAACAAGATCATTTGTGATCTTGTGGAAGAA
AAGTTTAAAGGAATCATTTCCATCTTGGATGAAGAGTGTC
TCCGGCCTGGAGATGCCAGTGACATCACCTTCCTGGAGAA
GCTTGAAAACACTGTCGGAGGCCACGCCCACTTCCTGACG
CATAAGCTTGCTGATGGAAAAACCCGTAAAGTGATGGGTC
GTGAGGAGTTCAGACTGATCCACTACGCAGGAGAAGTCAA
CTACAATGTGAAGGGCTTCCTGGACAAGAACAATGATCTC
CTTTTCAGAAACCTGAAGCAGGTCATGTGTATGTCTGAAA
ACAAAATACTCAATCAGTGTTTTGACAGAGAAGAGCTCTC
AGACAAGAAACGCCCAGAGACGGCAGCAACCCAGTTCAAG
AACAGCCTGGCGAAGTTGATGGAAATCCTGATGTCTAAGG
AGCCATCTTACGTGCGCTGCATCAAGCCTAATGATGCCAA
GCAAGCAGGGCGTTTTGATGAAGTCCTTATTAGACACCAA
GTAAAATATCTTGGTCTGATGGAAAACCTTCGGGTGAGGA
GAGCTGGCTTTGCATACCGGCGTCGCTACGAGACCTTCCT
ACAGAGGTATAAGTCTTTGTGTCCGGACACCTGGCCAAAC
TGGGACGGCCGTCAAGTGGATGGTGTGTCCACACTTGTCA
AGCACCTCGGCTACAAGCCCGAGGAGTACAAACTCGGCAG
GACCAAAATCTTCATCCGCTTCCCCAAGACCTTGTTTGCC
ACTGAAGACGCACTAGAAGTCAGGAAACACAGTCTTGCCA
CCCAACTTCAGTCATCCTGGAAGGGCTACAGTCAAAAAAC
CAAATACCAAAAAATGCGGCACTCGGCTGTCTGGATCCAA
GCCTGGTGGAGAGGAATTCTGGCCCGCAGGGCAGCAAAGC
GCAGGAGAGAGGCTGCCGACACCATTCGCAGGTTCATTAA
AGGCTTCATCTACCGCCACCAGCCGCGATGCCCAGAAAAC
GAGTACTTCCTGGATTACGTTCGCTACTCGTTCCTGATGA
ATTTGCACAGGTGCCAGCCTAAAACAGTTCTGGATAAGAG
CTGGCCAACACCACCTCCAGCACTGGTCGAGGCTTCACAG
CACCTCCGCAAACTCTGCATGCAGAACATGGTGAGGAAGT
ACTGCAAGAACATCAACCCAGAATGGAAGCATCAGATGGA
GCAGAAAGTGGTTGCGAGTAAAATCTTTAAGGACAAGAAG
GACAACTATCCTCAAAGCGTCCCAAAACTTTTTGTGAACA
CAAGGCTCAATGGTGAGGACATCAATCCTAAAGTGCTGCA
GGCTCTGGGAAACGAAAAGATGAAGTATGCTGTTCCAGTC
ATTAAGTATGACCGAAAAGGATATAAAGCACGCAACCGAC
AGCTCCTGCTCATGTCTGACAGTGCCGTTATTGTGGAGGA
GGGCAAACTCAAACAGCGGATCGACTACAACTCACTGAAA
GGGATTTCTGTCAGCTCTCTGAGCGACGGCATGTTTGTTT
TTCATGTTGCTTCTGAGGACAATAAGCAGAAGGGTGATGT
GGTGCTTCAGAATGAGCATGTCATTGAGACGTTAACCAAA
GTGGCTATCTGTGCTGACAAGATGGACGACATTAACATTA
ACCAGGGGAGTATAAAGTTCGATGTGGCACAGGGAAAAGA
AGGGATCATAGACTTTACAGCTGGCTCAGAGTTGCTGATA
GTCAAGGCTAAGAATGGACACCTTTCTGTGACCGCCCCTC
GCCTCAACTCAAGATGATGGACGAGTCGTGACCAAGCACT
TCCAGATACGCTCCTTAGTTCTTCAATCACATGACTACAG
GCGGAGCTTTTCTCCACCAATCAGACGCCGGCCAGCCAGC
CGCACCAAAGGCCTCTGCTTTCAGTTGCGAAAATCCAGCA
AACTTATTTATGTTTTGGGGGATTAATACTGCTATATGAA
TATATGATTTTATATGTCGAAGCCAAGAAATAACAATATA
TGTATGTGCATTTTTTCATCTTTATCTAGCTTATTTGGGG
GGTGTTGAATGATTTGTTAGAGACGGTGACCTCAGCCATG
ATCACGAGGTAAATCAGGGTTCACAATTAGCTTTGGTCCT
ATTTATGATTCTTTTTGCAATCCAAACCCACTCAGAACCA
GTACACATTTGCTTCTGTCACTATGATTTGAGTTATTATT
GCTTGGTAACTCAATCAAATGTTCATAGGAAAGGTATTAT
GACTTTTTTGCATAGAAAAGATGACTTTCAGATTCTGTTG
AACCTGTTTTACACACTATTTGTGCGACATAATTTCACTC
ACATGCCTAATAAGTTATTAATATTAGTTGATGTGAGGGA
TGTAAAATAAGGAGAGCATATGCCAAGTTTAATGAATGTG
ATTGTGTGTGATTTGTATGAAAAGGCTATGAAAATGATTG
GATTTTATTTCTTTTTCTAGAAAATCAGCCCTATTGTGAG
TCGTAATTCATAAACTACTTTAAAGGAGCACTCTTTGTTT
TTGCAAATAGGCTCTTTTGGAATTTTTACAAACCCCCTAT
AGTTAAACAGTTGCGTTTTACTATTTTAGCTTAGCATAAA
CTATTGAATCGGATTAGACCAGTAGTATCTCGCTCAAAGA
TATCAGAAAAGAGTTTAGATCATTTGACTATTCAAAGCTA
AACCTTTCTATAATTATAGTTATAAAGACCTACATAAATT
GAAAAGTTGATATGAATTTTTTTAATGAGATGCTAATGGT
CTAATCTGATTCAATGATTTATGCTAAGCTAAGCTAAAAG
TGCTCCTGCCATACCCGGATATAGGCTGAATGAATTTCAA
AATGGTAACTCAAAACTGTTTGACTCTTTGAAAGGTGAAG
AGTTTCAGAGAGGTGGAGAGGCCTCATAATGTTAGGATTG
GATTTAGAGAGTATCTTTGATAAGGGAAAGAAATGGGATG
AAATACAGTGATGGACAATTGATTCTTAAATCATTCAGGA
TTTTTTTCTCCTAATACTTTGGCCACAATAACCTCTCTTA
TTAATGTCATTTCCCCATGTTAGCATTACTCTAAGTTCTT
CATGAAGCTTGTGTCAATTGTTAGCTTTAATGGTATAAAA
ATTGTACATTATCTATTGTGATTCATAATTCATTGCCTAC
TTTAAAGGAGCACTGCACTTTTTTGGAAATAGGGTCATTT
TACAGGCCCCCTAAAGTCAATCAGTTAAGTTGTACTATTT
TTGAATTTATTAAAAGAAGCACTTTTAGCTTAGCTTAGCT
TTAATCATTGAATCGGATGAGACCATTAGAATTTGCTCAA
ATATTTTTTAAAAGAGTTCATATTTTTTATGAAATAAATC
TAAATCCTATGTAGTTACATCGTTTATAAGACCAACATAA
ATTGAAAAATTACTATGAATTTTTTTGAGCGAGATGCTAT
GGTCTAATCCGATTCAATGATTTATGCTAAGCTACGCTAA
AAGTGCTCCTGCCAGACATGGTGATTGGCTGAATGGATTA
AAACATGGTGAAACTCAACTGTTTAACTCTAGGAGACTTG
TAAAATGTTTCTCAAAAAGGAGGAGCGTTCCGTTAATTTG
AAAACTGACATCAGTAACAATTTTTTAATCTCAAAATTGT
GCCTCAAAAGGGTAAGATTGGATTCAGAGAGTGTCTTTGA
TAAGAAAAGATTCCCAAATCATTCAGGCTTTTTGCTCCTA
ATCCTTTGGACACAATAATCTCTCTTATTAATGCCATTTC
CCCATGTTAGCATTACTCTACGTTCACAAGCTTGTGTCAA
TTGTTAGCCTTAATAGAATGGAAGTTGTGAGTTATCTACA
GTTAATATGGAACTTGGCTTTCTTATTTTTCTGAGGCAGG
TTTGTGTATATGTAGATAAAAGGTAACAAAGCACTACTAA
ATGCTCAAAACCAAATGTAATATGTCATTTTTGAAACCAA
AAGTGAACTGTGGCACCTAACGCTGTTGGTAGCACAGTTA
TTTGATTTTGCCATTGAGCATGTGCCTATCATCACTAGTG
TCATAGTTGACGATGCTAAAGAAAAGAAAAACACTGTAAG
AAAGACACACGATTAAATAAAGTCAAGTGCCGCATGTATT
TAGAGCAAATATCTATTTTTGACATTTATTAAAACAAGAA
ATACAATACTATTTGCATAAGCTCTTGGCCCATTAATTAA
GATGTAATTCACAGTTTGTGAGTTTGTTTTATACTTTTTG
TGTAAAAAAGAAAAACCTGGAAAAATATATATGACATTTT
GAAGCAGACTGACAATGTATCTGAGCATATTAAAGCTGAT
TAAAAGCTGTGAGCGTCTGGTTTATGTATAGTTTTCATTT
GATAATGACAATAATTATTATTTGGAATGGAGAGAGTTTG
GATCATTTTCATATTTAAAGCTGAAGTGAAATGAATTGTT
TTGAGTGAGATGCTAATGGTCTAATCTGATTCAATGATGT
ATGCTAAGCTAAGCTAAAAGTTCTTCTACCAGACTGAATT
TACAAAATGGTAAATCTCAACTGTTTAACTCTTTAAAAAA
AGGTGAAGAGTTCTTTAATTTGAAAATTGAGGTCAATTAC
AATTTTTATTCTAAAATTTGTGCCTCATAATGTTAGGATT
GGATTTAAAGAGTATGTTTGATAAAAAAAGAAATGGGATG
AAATAAAGTGATGGACAATTGATTCTCAAA

myo1cb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA myo1cb-202 (1) 679
myo1cb-203 6430
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myo1cb-203 Contained in:

OTHER myo1cb-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000057506 (1)
  • Ensembl_Trans:ENSDART00000152777 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK028595 (1) 1172 bp
    GenBank:CN500808 (1) 842 bp
    GenBank:CT715433 (1) 829 bp
    GenBank:CT715434 (1) 701 bp
    GenBank:EB890409 (1) 690 bp
    GenBank:CO356105 (1) 560 bp
    GenBank:BU709904 (1) 542 bp
    GenBank:EB961630 (1) 521 bp
    GenBank:AI942569 (1) 507 bp
    GenBank:AL920871 (1) 493 bp
    GenBank:EB884116 (1) 479 bp
    CITATIONS (2)