Transcript

myo1cb-203

ID
ZDB-TSCRIPT-121213-184
Name
myo1cb-203
Previous Names
  • myo1cb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057506 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057506|OTTDARG00000040089|ZDB-GENE-090429-3 myo1cb|OTTDARP00000045065 myo1c-001 LG_none CR522882.5,CR478288.14 Danio rerio protein_coding NOVEL, 6430 bp
TTCCTGGTCGAGTGAAAGAGAGAGGGGGAGAGAGAGAGGG
CGGCTGCCGGGTTGGTAGTGGTAATATATCTCTAACACTC
GCTTCAAGCCAGTTCTGAGAGAATGTCCTTTGGCATGACG
TTAGTTACTTCAACTAGAGCATGACTCTGTGTTTATTTAC
ACTTAAATCTCCTGTAGTCTACATCTGCCAACACGACGTA
AAAGCGGATTTTTAGTGCCATACAGGGGTACATATTAAGG
TCGGTGGGATTCACACAGGAGAGAAAAGTGCAATTACAGC
TGAAGTGAGAGAAGAAGTTTCCCATCACCGCCGAGTGTCT
CTTATGCAGTATTACGGTTGTTTTGGACGTTGCGGGGTTT
GAAGTTGGCGTGCTTTAATCAAGGCTGTGGGCAGTGACGG
AATCCGGGTCATGATGGAGAGTGCCCTGACAGCCAGGGAC
CGGGTGGGTGTGCAGGATTTTGTCCTGCTGGAGAACCACA
CCAGCGAGGTGGCGTTCATTGAGAACCTCCGCAAACGCTT
CAAGGAGAACCTCATTTATACATACATCGGTTCAGTGCTG
GTGTCTGTAAATCCCTACAAAGATTTGGAGATCTACACTA
AACAGCACATGGAGAGATACAGGGGTGTCAATTTCTATGA
AGTGTCGCCTCACATTTATGCAGTGGCTGATAATGCATAT
CGCTCCATGCGGACTGAGAGACGGGACCAGTGCATCCTCA
TCTCGGGTGAAAGCGGTGCCGGCAAGACTGAAGCTTCCAA
GAAGGTTCTTCAGTACTACGCTGTCACCTGTCCTGCCAGT
GATCACGTGCAGACTGTCAAAGATCGCTTGCTACAATCCA
ACCCTGTGCTGGAGGCCTTTGGAAATGCAAAAACTTTAAG
AAATGACAATTCCAGTCGCTTTGGGAAATACATGGACATT
CAGTTTGACTTCAAGGGTGCTCCAGTCGGCGGTCACATCC
TGAACTACCTGCTAGAGAAATCCCGCGTCGTGCACCAAAG
CAACGGCGAGAGGAACTTCCATATCTTTTATCAGCTCATC
GAAGGAGGAGAGGACGATCTGCTTAGGAGACTAGGCCTGG
AGAGAAACGCCCAACAGTACCAGTATCTGGTCAAGGGTAA
CTGTCCTAAAGTGAGCTCAATTAATGACCGCAATGACTGG
AAGACAGTGAGGAAAGCCTTGAGCGTCATCGGCTTCACTG
ATGATGAAGTGGAGGAGCTTTTGAACATTATTGCCAGTGT
GCTACACTTGGGGAATGTCCAGTATGGAGGAGAGGACAGC
GGCAGTGCCTACATCACTACAGACACACAGATTAAATACT
TAGCCAGGTTGTTAGGCGTGGATGGCACAGTTCTTAAAGA
GGCTCTAACACATAAAAAGATTATTGCCAAAGGAGAAGAG
CTGATGAGTCCTTTAAATCAAGAGCAGGCCGCTTCGGCGC
GGGATGCTTTATCTAAAGCCATATACGGGCGGACTTTTTC
TTGGCTGGTCAACAAAATTAACGACTCTCTGGCCTTCAAG
GATGAGTCATTTAGCAGTAAGAACGCTTCTGTCATTGGCC
TGCTGGACATCTATGGTTTTGAGGTCTTTCAGAACAACAG
TTTTGAGCAGTTTTGCATCAACTATTGTAATGAGAAGCTG
CAGCAGCTCTTCATTGAACTGACCCTGAAGTCAGAGCAGG
AGGAATATGAAGCTGAGGGAATCACGTGGGAGCCTGTGCA
ATATTTTAACAACAAGATCATTTGTGATCTTGTGGAAGAA
AAGTTTAAAGGAATCATTTCCATCTTGGATGAAGAGTGTC
TCCGGCCTGGAGATGCCAGTGACATCACCTTCCTGGAGAA
GCTTGAAAACACTGTCGGAGGCCACGCCCACTTCCTGACG
CATAAGCTTGCTGATGGAAAAACCCGTAAAGTGATGGGTC
GTGAGGAGTTCAGACTGATCCACTACGCAGGAGAAGTCAA
CTACAATGTGAAGGGCTTCCTGGACAAGAACAATGATCTC
CTTTTCAGAAACCTGAAGCAGGTCATGTGTATGTCTGAAA
ACAAAATACTCAATCAGTGTTTTGACAGAGAAGAGCTCTC
AGACAAGAAACGCCCAGAGACGGCAGCAACCCAGTTCAAG
AACAGCCTGGCGAAGTTGATGGAAATCCTGATGTCTAAGG
AGCCATCTTACGTGCGCTGCATCAAGCCTAATGATGCCAA
GCAAGCAGGGCGTTTTGATGAAGTCCTTATTAGACACCAA
GTAAAATATCTTGGTCTGATGGAAAACCTTCGGGTGAGGA
GAGCTGGCTTTGCATACCGGCGTCGCTACGAGACCTTCCT
ACAGAGGTATAAGTCTTTGTGTCCGGACACCTGGCCAAAC
TGGGACGGCCGTCAAGTGGATGGTGTGTCCACACTTGTCA
AGCACCTCGGCTACAAGCCCGAGGAGTACAAACTCGGCAG
GACCAAAATCTTCATCCGCTTCCCCAAGACCTTGTTTGCC
ACTGAAGACGCACTAGAAGTCAGGAAACACAGTCTTGCCA
CCCAACTTCAGTCATCCTGGAAGGGCTACAGTCAAAAAAC
CAAATACCAAAAAATGCGGCACTCGGCTGTCTGGATCCAA
GCCTGGTGGAGAGGAATTCTGGCCCGCAGGGCAGCAAAGC
GCAGGAGAGAGGCTGCCGACACCATTCGCAGGTTCATTAA
AGGCTTCATCTACCGCCACCAGCCGCGATGCCCAGAAAAC
GAGTACTTCCTGGATTACGTTCGCTACTCGTTCCTGATGA
ATTTGCACAGGTGCCAGCCTAAAACAGTTCTGGATAAGAG
CTGGCCAACACCACCTCCAGCACTGGTCGAGGCTTCACAG
CACCTCCGCAAACTCTGCATGCAGAACATGGTGAGGAAGT
ACTGCAAGAACATCAACCCAGAATGGAAGCATCAGATGGA
GCAGAAAGTGGTTGCGAGTAAAATCTTTAAGGACAAGAAG
GACAACTATCCTCAAAGCGTCCCAAAACTTTTTGTGAACA
CAAGGCTCAATGGTGAGGACATCAATCCTAAAGTGCTGCA
GGCTCTGGGAAACGAAAAGATGAAGTATGCTGTTCCAGTC
ATTAAGTATGACCGAAAAGGATATAAAGCACGCAACCGAC
AGCTCCTGCTCATGTCTGACAGTGCCGTTATTGTGGAGGA
GGGCAAACTCAAACAGCGGATCGACTACAACTCACTGAAA
GGGATTTCTGTCAGCTCTCTGAGCGACGGCATGTTTGTTT
TTCATGTTGCTTCTGAGGACAATAAGCAGAAGGGTGATGT
GGTGCTTCAGAATGAGCATGTCATTGAGACGTTAACCAAA
GTGGCTATCTGTGCTGACAAGATGGACGACATTAACATTA
ACCAGGGGAGTATAAAGTTCGATGTGGCACAGGGAAAAGA
AGGGATCATAGACTTTACAGCTGGCTCAGAGTTGCTGATA
GTCAAGGCTAAGAATGGACACCTTTCTGTGACCGCCCCTC
GCCTCAACTCAAGATGATGGACGAGTCGTGACCAAGCACT
TCCAGATACGCTCCTTAGTTCTTCAATCACATGACTACAG
GCGGAGCTTTTCTCCACCAATCAGACGCCGGCCAGCCAGC
CGCACCAAAGGCCTCTGCTTTCAGTTGCGAAAATCCAGCA
AACTTATTTATGTTTTGGGGGATTAATACTGCTATATGAA
TATATGATTTTATATGTCGAAGCCAAGAAATAACAATATA
TGTATGTGCATTTTTTCATCTTTATCTAGCTTATTTGGGG
GGTGTTGAATGATTTGTTAGAGACGGTGACCTCAGCCATG
ATCACGAGGTAAATCAGGGTTCACAATTAGCTTTGGTCCT
ATTTATGATTCTTTTTGCAATCCAAACCCACTCAGAACCA
GTACACATTTGCTTCTGTCACTATGATTTGAGTTATTATT
GCTTGGTAACTCAATCAAATGTTCATAGGAAAGGTATTAT
GACTTTTTTGCATAGAAAAGATGACTTTCAGATTCTGTTG
AACCTGTTTTACACACTATTTGTGCGACATAATTTCACTC
ACATGCCTAATAAGTTATTAATATTAGTTGATGTGAGGGA
TGTAAAATAAGGAGAGCATATGCCAAGTTTAATGAATGTG
ATTGTGTGTGATTTGTATGAAAAGGCTATGAAAATGATTG
GATTTTATTTCTTTTTCTAGAAAATCAGCCCTATTGTGAG
TCGTAATTCATAAACTACTTTAAAGGAGCACTCTTTGTTT
TTGCAAATAGGCTCTTTTGGAATTTTTACAAACCCCCTAT
AGTTAAACAGTTGCGTTTTACTATTTTAGCTTAGCATAAA
CTATTGAATCGGATTAGACCAGTAGTATCTCGCTCAAAGA
TATCAGAAAAGAGTTTAGATCATTTGACTATTCAAAGCTA
AACCTTTCTATAATTATAGTTATAAAGACCTACATAAATT
GAAAAGTTGATATGAATTTTTTTAATGAGATGCTAATGGT
CTAATCTGATTCAATGATTTATGCTAAGCTAAGCTAAAAG
TGCTCCTGCCATACCCGGATATAGGCTGAATGAATTTCAA
AATGGTAACTCAAAACTGTTTGACTCTTTGAAAGGTGAAG
AGTTTCAGAGAGGTGGAGAGGCCTCATAATGTTAGGATTG
GATTTAGAGAGTATCTTTGATAAGGGAAAGAAATGGGATG
AAATACAGTGATGGACAATTGATTCTTAAATCATTCAGGA
TTTTTTTCTCCTAATACTTTGGCCACAATAACCTCTCTTA
TTAATGTCATTTCCCCATGTTAGCATTACTCTAAGTTCTT
CATGAAGCTTGTGTCAATTGTTAGCTTTAATGGTATAAAA
ATTGTACATTATCTATTGTGATTCATAATTCATTGCCTAC
TTTAAAGGAGCACTGCACTTTTTTGGAAATAGGGTCATTT
TACAGGCCCCCTAAAGTCAATCAGTTAAGTTGTACTATTT
TTGAATTTATTAAAAGAAGCACTTTTAGCTTAGCTTAGCT
TTAATCATTGAATCGGATGAGACCATTAGAATTTGCTCAA
ATATTTTTTAAAAGAGTTCATATTTTTTATGAAATAAATC
TAAATCCTATGTAGTTACATCGTTTATAAGACCAACATAA
ATTGAAAAATTACTATGAATTTTTTTGAGCGAGATGCTAT
GGTCTAATCCGATTCAATGATTTATGCTAAGCTACGCTAA
AAGTGCTCCTGCCAGACATGGTGATTGGCTGAATGGATTA
AAACATGGTGAAACTCAACTGTTTAACTCTAGGAGACTTG
TAAAATGTTTCTCAAAAAGGAGGAGCGTTCCGTTAATTTG
AAAACTGACATCAGTAACAATTTTTTAATCTCAAAATTGT
GCCTCAAAAGGGTAAGATTGGATTCAGAGAGTGTCTTTGA
TAAGAAAAGATTCCCAAATCATTCAGGCTTTTTGCTCCTA
ATCCTTTGGACACAATAATCTCTCTTATTAATGCCATTTC
CCCATGTTAGCATTACTCTACGTTCACAAGCTTGTGTCAA
TTGTTAGCCTTAATAGAATGGAAGTTGTGAGTTATCTACA
GTTAATATGGAACTTGGCTTTCTTATTTTTCTGAGGCAGG
TTTGTGTATATGTAGATAAAAGGTAACAAAGCACTACTAA
ATGCTCAAAACCAAATGTAATATGTCATTTTTGAAACCAA
AAGTGAACTGTGGCACCTAACGCTGTTGGTAGCACAGTTA
TTTGATTTTGCCATTGAGCATGTGCCTATCATCACTAGTG
TCATAGTTGACGATGCTAAAGAAAAGAAAAACACTGTAAG
AAAGACACACGATTAAATAAAGTCAAGTGCCGCATGTATT
TAGAGCAAATATCTATTTTTGACATTTATTAAAACAAGAA
ATACAATACTATTTGCATAAGCTCTTGGCCCATTAATTAA
GATGTAATTCACAGTTTGTGAGTTTGTTTTATACTTTTTG
TGTAAAAAAGAAAAACCTGGAAAAATATATATGACATTTT
GAAGCAGACTGACAATGTATCTGAGCATATTAAAGCTGAT
TAAAAGCTGTGAGCGTCTGGTTTATGTATAGTTTTCATTT
GATAATGACAATAATTATTATTTGGAATGGAGAGAGTTTG
GATCATTTTCATATTTAAAGCTGAAGTGAAATGAATTGTT
TTGAGTGAGATGCTAATGGTCTAATCTGATTCAATGATGT
ATGCTAAGCTAAGCTAAAAGTTCTTCTACCAGACTGAATT
TACAAAATGGTAAATCTCAACTGTTTAACTCTTTAAAAAA
AGGTGAAGAGTTCTTTAATTTGAAAATTGAGGTCAATTAC
AATTTTTATTCTAAAATTTGTGCCTCATAATGTTAGGATT
GGATTTAAAGAGTATGTTTGATAAAAAAAGAAATGGGATG
AAATAAAGTGATGGACAATTGATTCTCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations