Transcript

cr382300.2-201

ID
ZDB-TSCRIPT-121213-599
Name
cr382300.2-201
Previous Names
  • dkey-25e11.11-001
  • ottdart00000058142
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058142 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058142|OTTDARG00000040489|ZDB-GENE-000823-1 hoxa9a|OTTDARP00000045522 DKEY-25E11.11-001 LG_ CR382300.12 Danio rerio protein_coding PUTATIVE, 498 bp
GTTATACCGGGCAGCGAGGAGACTCGCTTCTCCTCGGGTT
TAGGGCTTATTCAGCACAGGCCAACCATTCTACCTGCAGA
CCTTTCAGACCTCGGCCCCTGCACATTCCCGGCAAAGCAA
CCCGTTTATGGTACCTCAGATTGGGGGCACATCCCAACGC
ACTTCTCCACTGGTGTACCGTCAGTATATCAGCCCCATGC
GCAACCTCCAGTAGTTGGGGATTATGTGCAGTCTTGGCTC
TTGGATTCTGCATGTGGGTTACCTCAAACTGAGCCACCGA
CGGTTAATCACAATCATGCCAAATCCGATACGAATGAAAC
GAATGATGACGGCACGGAATACAGTCCGCATACTATACTA
CAGCCTGAAGTCTTCACAAACGGAGGATGTTCTACCAAAA
CAGAAGCAGAATCTAGCCGAACTGCTGAAAAGAGTGGCGA
CATCGAGGGGAAACCGGGCGCTGATCCAGACCGTAGAGGT
GTTTCTTGACTGCACCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations