Transcript

hoxa9a-201

ID
ZDB-TSCRIPT-090929-4020
Name
hoxa9a-201
Previous Names
  • hoxa9a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018144 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018144|OTTDARG00000015150|ZDB-GENE-000823-1 hoxa9a|OTTDARP00000034474 hoxa9a-002 LG_ CR382300.12 Danio rerio protein_coding KNOWN, 926 bp
CGGCAAGAATTAAGACGTTCAGATTTAGGACGCAAAACAG
TATTTTTCCGAGGTCACAATTTTACGCCAACAGAGAGCGC
TCCTGCCATGTCGACATCCGGAGCTTTGACAGGATACTAC
GTTGACTCTATTGTTATACCGGGCAGCGAGGAGACTCGCT
TCTCCTCGGGTTTAGGGCTTATTCAGCACAGGCCAACCAT
TCTACCTGCAGACCTTTCAGACCTCGGCCCCTGCACATTC
CCGGCAAAGCAACCCGTTTATGGTACCTCAGATTGGGGGC
ACATCCCAACGCACTTCTCCACTGGTGTACCGTCAGTATA
TCAGCCCCATGCGCAACCTCCAGTAGTTGGGGATTATGTG
CAGTCTTGGCTCTTGGATTCTGCATGTGGGTTACCTCAAA
CTGAGCCACCGACGGTTAATCACAATCATGCCAAATCCGA
TACGAATGAAACGAATGATGACGGCACGGAATACAGTCCG
CATACTATACTACAGCCTGAAGTCTTCACAAACGGAGGAT
GTTCTACCAAAACAGAAGCAGAATCTAGCCGAACTGCTGA
AAAGAGTGGCGACATCGAGGGGAAACCGGGCGCTGATCCA
GAAAACCCTGTGTCCAACTGGCTTCATGCGAGCTCGACGC
GTAAAAAACGCTGTCCTTATACTAAGCACCAGATCCTCGA
GCTGGAGAAAGAGTTTTTATTTAACACTTACCTCACGCGC
GACCGGCGATACGAAGTCGCCCGTCTACTGAACCTCACGG
AGAGACAGGTCAAAATTTGGTTCCAAAACCGCAGGATGAA
GATGAAAAAGTTCAACAAAAATGAAACGAAGGAAGACTAA
GACTAAAGCACTTCATGTAGGTGAGGATGAGAGATGATCC
ATCCTGTTACTGAATTTATTTTGTTGTGGGATTTTACGTT
AGATTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations