header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-588
Transcript Name: rnls-203
Previous Names: rnls-004, ch211-225j11.2-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058107 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058107|OTTDARG00000021769|ZDB-GENE-040718-351 rnls|OTTDARP00000045498 CH211-225J11.2-004 LG_none CR735129.11,AL731788.8 Danio rerio protein_coding KNOWN, 685 bp
AATCGTGTAAGATCTTCAGACAAGCGCGAACGCTTTGCTT
TTCTACCTCAAACAGTTGTTTATTCACATTTTCTAAAAAT
GTCCCGAGTTCTTATAGTTGGGGCTGGACTCACAGGTAGT
TTATGTGCCTGTCTGCTGAGGAGGGAACTGCCAAACAAAG
TTAATATAGTCGTGTGGGACAAATCTCGCGGTGCAGGGGG
TAGAATGTCCACAAGCAGAAGTCCAAACAATCCTTCTTGC
TCGGTTGATCTTGGAGCTCAATACATCAGTGCCACACAGT
ACTATGCTCAAATTCACAGCAGCTTTTATGAAGAACTCCT
AGCGCAAGACATTTTAAAACCCCTCAGTGCTCCTGTTGAA
GGCCTGATGGTAAAGGAAGAAGGAATGGTGAACTATGTGA
CACCTCATGGGGTCTCCTCCATCGTCAAACACTATCTCAA
AGAGTCAGGAGCAGAGGTTTTCTACAACCGACACGTCACT
CACATTCACCGGAAAGACACTGGCTGGGAAGTGTGTCGCA
AAGAAGGAGCTCCAGAGCGGTTTGACGTAGTGGTTTTAAC
CATGCCAGTTCCCCAAATCCTCCAGCTGCAAGGAGACGTG
GGTTCTTTGATGGGGGAGAATCAGAGGAGAAAGCTGGAGG
CTGTCAGCTACTCTTCCCGCTACGCACTTGGACTCTTCTA
CAAAG

rnls TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rnls-201 (1)    Ensembl 1456
rnls-203 685
ncRNA rnls-002 (1)    Ensembl 759
rnls-003 (1)    Ensembl 894
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rnls-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058107 (1),  Ensembl_Trans:ENSDART00000152452 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DN835774 (1) 768 bp
GenBank:BI562796 (1) 435 bp
CITATIONS (2)