header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-901
Transcript Name: rnls-003
Previous Name: ch211-225j11.2-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058108 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058108|OTTDARG00000021769|ZDB-GENE-040718-351 rnls|no_translation CH211-225J11.2-003 LG_none CR735129.11,AL731788.8 Danio rerio protein_coding KNOWN, 894 bp
AAGATCTTCAGACAAGCGCGAACGCTTTGCTTTTCTACCT
CAAACAGTTGTTTATTCACATTTTCTAAAAATGTCCCGAG
TTCTTATAGTTGGGGCTGGACTCACAGGTAGTTTATGTGC
CTGTCTGCTGAGGAGGGAACTGCCAAACAAAGTTAATATA
GTCGTGTGGGACAAATCTCGCGGTGCAGGGGGTAGAATGT
CCACAAGCAGAAGTCCAAACAATCCTTCTTGCTCGGTTGA
TCTTGGAGCTCAATACATCAGTGCCACACAGTACTATGCT
CAAATTCACAGCAGCTTTTATGAAGAACTCCTAGCGCAAG
ACATTTTAAAACCCCTCAGTGCTCCTGTTGAAGGCCTGAT
GGTAAAGGAAGAAGGAATGGTGAACTATGTGACACCTCAT
GGGGTCTCCTCCATCGTCAAACACTATCTCAAAGAGTCAG
CAGGAGCAGAGGTTTTCTACAACCGACACGTCACTCACAT
TCACCGGAAAGACACTGGCTGGGAAGTGTGTCGCAAAGAA
GGAGCTCCAGAGCGGTTTGACGTAGTGGTTTTAACCATGC
CAGTTCCCCAAATCCTCCAGCTGCAAGGAGACGTGGGTTC
TTGTGAGTACATTACCACATCGCCGCAGACACATATAAAC
ACACACTTTGGCCTTAAAATTGAAATATGACTTTTGGTTT
TGCTGTCTGCCATTGTTTCTGCTGAAAATGCATCCCAGTG
AAGTCTCATCATTTTTTAATTTGGTCTTATTTCAGAAATA
TCCATAGAAGATTTCAAAAGTTATTCAAAATTCTCTATTA
AGTGAACTTCTATTAAAGTAAACTTTAGTTTAAGCATTTT
TACTTGTATTAAGCTCAATCACAACTAACAACTTTACACA
TTTATTGGAAATTA

rnls TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rnls-201 (1)    Ensembl 1456
rnls-203 (1)    Ensembl 685
ncRNA rnls-002 (1)    Ensembl 759
rnls-003 894
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rnls-003 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058108 (1),  Ensembl_Trans:ENSDART00000152696 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH453909 (1) 926 bp
GenBank:EH479671 (1) 888 bp
CITATIONS (2)