ZFIN ID: ZDB-TSCRIPT-090929-10372
Transcript Name: rnls-201
Previous Names: rnls-001, zgc:92286-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027830 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027830|OTTDARG00000021769|ZDB-GENE-040718-351 rnls|OTTDARP00000022779 CH211-225J11.2-001 LG_none CR735129.11,AL731788.8 Danio rerio protein_coding KNOWN, 1456 bp
ATAATACTTAAAGGGACAGTACAATAAATCGTGTAAGATC
TTCAGACAAGCGCGAACGCTTTGCTTTTCTACCTCAAACA
GTTGTTTATTCACATTTTCTAAAAATGTCCCGAGTTCTTA
TAGTTGGGGCTGGACTCACAGGTAGTTTATGTGCCTGTCT
GCTGAGGAGGGAACTGCCAAACAAAGTTAATATAGTCGTG
TGGGACAAATCTCGCGGTGCAGGGGGTAGAATGTCCACAA
GCAGAAGTCCAAACAATCCTTCTTGCTCGGTTGATCTTGG
AGCTCAATACATCAGTGCCACACAGTACTATGCTCAAATT
CACAGCAGCTTTTATGAAGAACTCCTAGCGCAAGACATTT
TAAAACCCCTCAGTGCTCCTGTTGAAGGCCTGATGGTAAA
GGAAGAAGGAATGGTGAACTATGTGACACCTCATGGGGTC
TCCTCCATCGTCAAACACTATCTCAAAGAGTCAGCAGGAG
CAGAGGTTTTCTACAACCGACACGTCACTCACATTCACCG
GAAAGACACTGGCTGGGAAGTGTGTCGCAAAGAAGGAGCT
CCAGAGCGGTTTGACGTAGTGGTTTTAACCATGCCAGTTC
CCCAAATCCTCCAGCTGCAAGGAGACGTGGGTTCTTTGAT
GGGGGAGAATCAGAGGAGAAAGCTGGAGGCTGTCAGCTAC
TCTTCCCGCTACGCACTTGGACTCTTCTACAAAGCCGACA
CACGGATCGACGTCCCTTGGGCGGCCAAGTACGTCTCAAA
TAATCCCTGCATTCGCTTCATCGCCATAGATGATAAAAAG
CGCAATTTAGAATCAAAAGTCTCCGGACCTTCTGTGGTGG
TCCACACCAGTGTGCCCTTTGGCATCCAGCACTTGGAAGA
GGAGAAGGATGCTGTGCAGCCCATCATTCTGGAAGAGCTG
AAAAAGCTGATGCCAGAGCTGCCTAAACCTGAGAGTGTCA
AGTGTCAGAAGTGGAGATATTCACAGGTGACAAGATCGGT
GGCTGATTGCCCAGGGCAGATGACAGTGCTCTCCCAGCCT
CTGCTGGTGTGTGGGGGGGACGGATTCACACACTCCAATT
TCGACGGCTGCATCGAGTCTGCCCTGAAGGTCTTTGCGGT
TCTGAAGTCTTCTCTTTGAAAGGAGGTTGGAAAAGTATGC
CTTTATTTTTGGTTTTTATTATGAAGGATGGCACATTGAT
TTAGATTTAAGCCCCTCACTGCAGGAAGATGGATGTACTG
CACAAAGCACAGTCTCGTCTGGGTGTGCAGACGCATTTTG
TAACAAAAACCAATTATATAGGATTAAAGACAACCGAGCA
CTGTGCAGCTTCAGTTGTGACAGAGCCTGATGCCTCAAAC
TGGATTTAACAATGTCTTGAGCTATGGTGTTCTGGATGTG
TAGCAGATATTTTGTGTAGTCTGAGATTAATAAAAAATTA
TTGATACATGCTTGAA

rnls TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rnls-201 1456
rnls-203 (1)    Ensembl 685
ncRNA rnls-002 (1)    Ensembl 759
rnls-003 (1)    Ensembl 894
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rnls-201 Contained in:
[BAC] CH211-225J11 (1), RP71-1G13 (1)

Genome Resources: Vega_Trans:OTTDART00000027830 (1),  Ensembl_Trans:ENSDART00000014536 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC075985 (1) 1436 bp
GenBank:EH594382 (1) 988 bp
CITATIONS (2)