Transcript

myo6a-205

ID
ZDB-TSCRIPT-121213-545
Name
myo6a-205
Previous Names
  • myo6a-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057975 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057975|OTTDARG00000032128|ZDB-GENE-040819-2 myo6a|OTTDARP00000045403 myo6a-004 LG_ CU469066.12 Danio rerio protein_coding KNOWN, 542 bp
ACGATGGAAAGCCGGTGTGGGCGCCTCACCCTACAGACGG
GTTCCAGCTGGGCAGGATCATCGACATCAGTGCCGATAGT
CTGACCATCGAACCTCTCAACCAGAGAGGAAAGAACTTCC
AAGCTCCCGTGGATCAAGTCTTCCCTGCTGAGGATGATGT
CAACAAACATGTCGAGGACAACTGCTCGTTGATGTACTTG
AATGAAGCCACGCTTCTGAATAATGTCCGTGTGCGCTATA
GCAAAGACAAGATTTATACGTTCGTGGCCAACATCCTGAT
TGCTGTGAATCCATATTGTGAGATTCCTAAGCTGTATTCT
CCAGAGACCATTAAACAGCCAGCAGTGCCCGGGACGCCCT
GGCTAAAGCCATCTACAGCCGGCTCTTTGATCATGTGGTC
ACCAGGATCAACCAGTGCTTCCCCTTCGACTCGTCTGCGC
ACTTTATTGGTGTTCTGGACATCGCAGGCTTCGAGTACTT
TGAGCACAACAGTTTCGAGCAGTTCTGCATCAACTACTGT
AATGAGAAACTCCAGCAGTTCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations