Transcript

myo6a-003

ID
ZDB-TSCRIPT-110325-2205
Name
myo6a-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049042 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049042|OTTDARG00000032128|ZDB-GENE-040819-2 myo6a|no_translation myo6a-003 LG_ CU469066.12 Danio rerio protein_coding KNOWN, 536 bp
TTGAGCACAACAGTTTCGAGCAGTTCTGCATCAACTACTG
TAATGAGAAACTCCAGCAGTTCTTTAATGAGCGCATTCTC
AAGGAGGAGCAGGAACTGTATCAGAAAGAAGGCCTGGGAG
TCAATGAAGTGCACTACGTTGATAATCAGGACTGTATAGG
TCTGTATCTCAGATAAAACTCTGACTTGATTGAGCTGTTG
AAATGATATCTGTATTATATCTACCCCTTTTATCTTCTTT
GGTTCAGACTTGGTGGAGTCGAAGGTAGTAGGCATCTTGG
ACATCCTGGATGAAGAAAACCGACTACCTCAACCCAGCGA
CCAGCACTTTACTGAAACCGTCCACAGCAAACACAAGGAC
CATTTCCGGCTGACTGTTCCCAGAAAGTCTAAGCTGCAGG
TGCACAGGAACGTCCGAGACGACGAGGGCTTCATCATAAG
ACACTTCGCTGGAGCAGTCTGCTATGAAACGACTCAGTTT
GTGGAGAAGAATAATGACGCTCTGCACATGTCTCTGGCGT
GTTTGGTGAGCGAGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations