Transcript

exoc6-202

ID
ZDB-TSCRIPT-121213-509
Name
exoc6-202
Previous Names
  • exoc6-001
  • ottdart00000057687
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057687 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057687|OTTDARG00000021750|ZDB-GENE-040426-2511 exoc6|OTTDARP00000045198 exoc6-001 LG_ BX323992.9 Danio rerio protein_coding KNOWN, 3798 bp
ATGGCGGAGAGCGAGAGCTTGGAGACTATCACCGAACATG
AACGAATATTACAAGAGATCGAGAGCACGGACACTGCGTG
TCTGGGGCCGACTTTACGATCTGTTTACGATGATCAGCCC
AACGCACACAAAAGGTTTATGGAGAAGCTTGATGCCAGAA
TACGTAACCACGACAGAGAGATTGAAAAAATGTGCAACTT
TCATCATCAGGGATTCGTCGACGCCATCACAGAACTGCTG
AAGGTCCGAGCAGATGCTGAGAAACTGATGGGCCAAGTGA
GCGACACCAACCGAAGACTTCAAGACGCCGGACGGGAGGT
GACGGCCCAAACCGAGGAGGTCATCCGCTGCCGGGTTCAG
CAGAGGAACATGGCCACCACCGTGGAGAAGTTGCAGCTCT
GCATTCCCGTTCTGGAAATGTACAGCAAATTGAAGGAGCA
GCTTGAATCAAAAAGATACTACTCTGCACTGAAAACCATG
GAGCAGCTAGAAAACATTTATATTCCCAGAGTGAGCCAGT
ACAGGTTCTGCCAGATCATGGCTGAGACTCTCCCAAAACT
CAGAGAGGAGATTAAAGAGATCTCCATGTCTGATCTGAAA
GACTTCTTAGAAAGTATCCGAAAGCACTCAGATAAGATTG
GGGAAACCGCAATGAGACAGGCTCAGCAGCACCGTACGTT
CAACAGTGCAGTTCAGAAGCAGGTCACTCTGAGTTGTGCC
AAACCTCTGTATGGGCTAAATGGCCGAACGCCCCTCCATC
ACAACGGCTTAAGCACAGACACAGCAGAGGAAGAAGAGAT
AGATGAGGAGGTCTTGACGGCTCAGGATCTGGTGGACTTT
TCGCCGGTCTACCGATGTCTCCACATCTACACTGTTTTGG
GAGACAGAGAGACATTTGAAAATTACTATAGGAAACAAAG
GAAAAAACAAGCAAGACTTGTACTACAGCCTCAGTCTAAC
ATGCACGAAACAGTGGAGGGCTACAGGAAGTACTTTAATC
AAATTGTTGGGTTTTTTGTGGTGGAGGATCACATATTACA
CGCCACACAAGGCCTGGTGACCAGAGCCTTCACCGACGAG
CTGTGGAACATGGCGCTGTCCAAAATCATCGCAGTTCTCC
GCACACACTCTTCCTACTGCAACGATCCTGACCTGGTCCT
AGAACTGAAGAACCTGATAGTTATTTTTGCAGACACTTTA
CAGGGTTATGGCTTCCCTGTGAACAGACTTTTTGACCTGT
TGTTTGAGGTTCGAGATCAATACAATGAAACATTGCTCAA
GAAATGGGCCTTGGTGTTCAGGGATATTTTTGAGCAGGAC
AACTACAGCCCCATTCCTGTGGATACTGAAGAGGAGTATA
AGGCCGTGGTCAGTCGCTTTCCCTTCCATGATGCAGAGAT
CGAAAAGCAACAATTCCCAAAGAAGCTGCCCATGTCCCAG
TCAGTGCCTCAGATCTACTCTCAAGTGAAGGAGTTTATTT
ATGCCAGCTTGAAGTTCTCCGAGTCACTCCATCGCAGCTC
AACCGAGATCGACGACATGCTCCGTAAATCCACCAACCTG
CTGTTGACGAGGACCTTGAGCAGCTGCTTACAAAACCTCA
TCAAAAAACCACACATTGGATTAACAGAGCTTGTTCAAAT
CATCATCAACACCACCCACTTAGAGCACGCATGTAAATAC
CTGGAGGATTTTATCACGAACATCACCAATGTTTCCCCGG
AAACGGTTCACACCACAAGACTTTACGGGCTTTCCACCTT
CAAGGATGCCAGACATGCAGCTGAAGGGGAAATCTACACT
AAACTCAACCAGAAGATCGACGAGTTCATTCAGCTGGCGG
ATTATGAATGGGGAATGGCGGAGTCGGATGGCAGGGCCAG
CGGCTACCTCATGGACCTCATTAACTTCCTGCGCAGCACC
TTCCAGGTCTTCACCCACCTTCCGGGTAAAGTGGCACAGA
CGGCGTGTATGTCGGCCTGTAAACATCTGGCCACGTCACT
GATGCAGATGCTGCTGGACACTGAGCTCAAACAGATCAGC
ATGGGAGCCATTCAGCAGTTCAACCTGGATGTTATACAGT
GTGAATTGTTTGCCAGTTCAGAGCCTGTACCAGGATTCCA
GGGGGACACGCTGCAGTTGGCCTTTATTGACCTCCGACAG
CTCCTAGATCTGTTCATGGTGTGGGATTGGTCCACGTATC
TGGCAGACTACGGGCAGCCAACCTCAAAGTACCTGCGGGT
GAACCCATCCACTGCGCTAGCACTTTTGGAGAAGATGAAA
GACACGAGTAAAAAGAACAACATCTTCTCCCAGTTCAGGA
AGAATGATCGCGACCGGCAGAAGCTGATCGAGACTGTGGT
GAAGCAGCTGAGAAGTCTGGTCAATGGCATGTCCCAGCAT
TCCTAGAGTCGTCCACATGAACTCCAAACACTGGGTTTGA
CAATATAACTTATAAATTAGATTTTCTTTTCATTGGCCCC
CCCTTGTTTTTTGTTTTGCTCAAAATCCAGTAACTCACTG
TAAAGTAAGAACTCTCCGAAAAGTACCGTGGTATATATTT
TGACTGCATCCTCCATGTCTTCTGCCAAAATATTCACCAC
TGTAGGCTAATAATGTAAATATCGGGCAAAGATGAAGAAA
GAAAAAAAAGAAGTGAACAGAAGTTATGCAGTAATTTTTT
GTAATGTATTTTTAAAGGTTGAGAATTATGTTTTGTACGT
TGTGAAAGTGCAATGACTCTAACACTACACTTGAGAGAGT
GTGTGTGCGTGTGTGTGACTGCTGATCGGTCATATTGCAA
CCTGTATGAAATTCTCCCTAGCGTACCATGGATGAAGTTT
TTATTGTACATATTTTTAAATATATTTAACTCTCCTATGG
AATCATGCTTCCCATGGGTCTGCCTTGAGTTGAGTTTGAC
TCACATTAGGTAAGTCATCAATGCTAAAAACATTTGCATG
AGAGTGCTTCGTTTTTATTTCGCTTTCAAGTCGACAGGCT
TCAAACAAAAGAATCTAAAACTGTCGGCTCCGTTTGAAGG
AATGTTGCACAAATGCGCCACAGAATTATATTTAATTTTA
ATTTCCTCAGGGTGAATTGAAAGCTTTGGGTTCAAATGCT
TTAGTATTCTTTAGATTTCTTTTTTATTATTAAAATGAGC
AATAATTGGTCCAGCTACAGAGAAACGTTAGCTTCATTTC
ATAGTTTCAACCTATTTTGTTTTCTTCAATTGATTTTCCT
GGGCATTTTTGCACTGATTAAAAGATTATTTAAGTTTGCC
TTTCAACAAGCAACTGTATATGCTAATGTATTTAAATGAC
CATTGTATATACCACACTATTTTGTTAAAATTGGGCGGGA
AAAAATGGAATGTAAAGATAAAACTTCTGTCGTTAGCTCT
GAGTGGTCCCATATGTACGTTTCCTGTGATCTCACGACTG
TAACGACACTAATTCTGGTTCTGCTTTAAAATAACTCTCA
TGACCTGCTTAACAAATCAGTAGTTGCGTTATGTTCCGAT
ATTAAAATATATTAAATGAAGACATTTTGAATATGCATTA
ACTAATGATATGTTAAGCATTGTGTAATGTTTGTTATAAT
ATTACTGAAGGTTAATATGAAGTGTAACCCTGATGAGGAT
CACCATATCCCAAAGTCTCCCCCTGCATTACCTGGAGTTC
CTCAAACCCAAGTGACTTCAGATGTTTTCAAGGTCCACTC
ATTTTTATTTGTGTGCTTTAATAAAATATGATCACAAAAA
TATAGTTGTTGTTGGTGTTGCTGTTTTCTGCCTAATGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations