Community Action Needed: Please respond to the NIH RFI
Transcript

exoc6-005

ID
ZDB-TSCRIPT-121213-201
Name
exoc6-005
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057689 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057689|OTTDARG00000021750|ZDB-GENE-040426-2511 exoc6|no_translation exoc6-005 LG_ BX323992.9 Danio rerio protein_coding KNOWN, 354 bp
CTCCATGTCTGATCTGAAAGACTTCTTAGAAAGTATCCGA
AAGCACTCAGATAAGATTGGGGAAACCGCAATGAGACAGA
TATCTGCTTGCAAAGTGCTTACAAGTGTGAATCATCAGCA
CTTCAAATCATCAGAGAGTAGCACTATATAAATGCTATGA
GTATAAGTTTTTTTTCTGATCATACGGAAAGGATTGTTTG
AAAGCCCACTCACTGGTGTGGAACACACTCAGAATTGCAC
AATGTTTTATGGGGTGCTTATAAAAATGTGTCTGGTGCAT
ATGAAAAATTGTGTCACTTACAGGTGGTTTGTCAAATCAT
TCCACCTGCATGAAACACCTAATGTCTTTTTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations