Community Action Needed: Please respond to the NIH RFI
Transcript

exoc6-003

ID
ZDB-TSCRIPT-090929-10333
Name
exoc6-003
Previous Names
  • exoc6-001
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027790 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027790|OTTDARG00000021750|ZDB-GENE-040426-2511 exoc6|no_translation exoc6-003 LG_ BX323992.9 Danio rerio protein_coding KNOWN, 3767 bp
GGAAACACAGTTCAAACCAGCACACAGACCATCATGTACG
ACAGCAGCAGCAGCCTCAAGATCCCCAGCAGTCCCCAAGA
AGAGGACAAAGCTGAAGGAAAAGTCTATGGGAATGTTTTT
GCAGAACTGGAATCAGTAGATCTGCCGCTGGGAACGAGTT
TAAGATCTGTTTACGATGATCAGCCCAACGCACACAAAAG
GTTTATGGAGAAGCTTGATGCCAGAATACGTAACCACGAC
AGAGAGATTGAAAAAATGTGCAACTTTCATCATCAGGGAT
TCGTCGACGCCATCACAGAACTGCTGAAGGTCCGAGCAGA
TGCTGAGAAACTGATGGGCCAAGTGAGCGACACCAACCGA
AGACTTCAAGACGCCGGACGGGAGGTGACGGCCCAAACCG
AGGAGGTCATCCGCTGCCGGGTTCAGCAGAGGAACATGGC
CACCACCGTGGAGAAGTTGCAGCTCTGCATTCCCGTTCTG
GAAATGTACAGCAAATTGAAGGAGCAGCTTGAATCAAAAA
GATACTACTCTGCACTGAAAACCATGGAGCAGCTAGAAAA
CATTTATATTCCCAGAGTGAGCCAGTACAGGTTCTGCCAG
ATCATGGCTGAGACTCTCCCAAAACTCAGAGAGGAGATTA
AAGAGATCTCCATGTCTGATCTGAAAGACTTCTTAGAAAG
TATCCGAAAGCACTCAGATAAGATTGGGGAAACCGCAATG
AGACAGGCTCAGCAGCACCGTACGTTCAACAGTGCAGTTC
AGAAGCAGGTCACTCTGAGTTGTGCCAAACCTCTGTATGG
GCTAAATGGCCGAACGCCCCTCCATCACAACGGCTTAAGC
ACAGACACAGCAGAGGAAGAAGAGATAGATGAGGAGGTCT
TGACGGCTCAGGATCTGGTGGACTTTTCGCCGGTCTACCG
ATGTCTCCACATCTACACTGTTTTGGGAGACAGAGAGACA
TTTGAAAATTACTATAGGAAACAAAGGAAAAAACAAGCAA
GACTTGTACTACAGCCTCAGTCTAACATGCACGAAACAGT
GGAGGGCTACAGGAAGTACTTTAATCAAATTGTTGGGTTT
TTTGTGGTGGAGGATCACATATTACACGCCACACAAGGCC
TGGTGACCAGAGCCTTCACCGACGAGCTGTGGAACATGGC
GCTGTCCAAAATCATCGCAGTTCTCCGCACACACTCTTCC
TACTGCAACGATCCTGACCTGGTCCTAGAACTGAAGAACC
TGATAGTTATTTTTGCAGACACTTTACAGGGTTATGGCTT
CCCTGTGAACAGACTTTTTGACCTGTTGTTTGAGGTTCGA
GATCAATACAATGAAACATTGCTCAAGAAATGGGCCTTGG
TGTTCAGGGATATTTTTGAGCAGGACAACTACAGCCCCAT
TCCTGTGGATACTGAAGAGGAGTATAAGGCCGTGGTCAGT
CGCTTTCCCTTCCATGATGCAGAGATCGAAAAGCAACAAT
TCCCAAAGAAGCTGCCCATGTCCCAGTCAGTGCCTCAGAT
CTACTCTCAAGTGAAGGAGTTTATTTATGCCAGCTTGAAG
TTCTCCGAGTCACTCCATCGCAGCTCAACCGAGATCGACG
ACATGCTCCGTAAATCCACCAACCTGCTGTTGACGAGGAC
CTTGAGCAGCTGCTTACAAAACCTCATCAAAAAACCACAC
ATTGGATTAACAGAGCTTGTTCAAATCATCATCAACACCA
CCCACTTAGAGCACGCATGTAAATACCTGGAGGATTTTAT
CACGAACATCACCAATGTTTCCCCGGAAACGGTTCACACC
ACAAGACTTTACGGGCTTTCCACCTTCAAGGATGCCAGAC
ATGCAGCTGAAGGGGAAATCTACACTAAACTCAACCAGAA
GATCGACGAGTTCATTCAGCTGGCGGATTATGAATGGGGA
ATGGCGGAGTCGGATGGCAGGGCCAGCGGCTACCTCATGG
ACCTCATTAACTTCCTGCGCAGCACCTTCCAGGTCTTCAC
CCACCTTCCGGGTAAAGTGGCACAGACGGCGTGTATGTCG
GCCTGTAAACATCTGGCCACGTCACTGATGCAGATGCTGC
TGGACACTGAGCTCAAACAGATCAGCATGGGAGCCATTCA
GCAGTTCAACCTGGATGTTATACAGTGTGAATGTGAGTAG
GATCAATTACTGCACATTTACAATGCCAATTCAATGCAGC
CTTTATACAGTTGCATACCCCTCACCATGGCTGATGCTGA
GCACCTCTCTATAAATGTAACTAGTCGTCACAACGACTCC
TAGCACATGCTCTTGGTAGCTGTGACCAATGCGGGCGTAA
CCGAGAGCCGGTTAAACCTATTGGAGGGAGTGTCCTGTGA
AGTAGCTCTAGATGAAAACTGTTGTTTTGTTTTTATCTTA
TAATTAAAGTTGTTGCTTGTTCGCCGATTCCCGCCTCAGA
ATGAGCTAGTTTTAGCTACTTGTACATTAAGGTAGCGTTA
AAAAAAACAAAACACCCGCAAAGAAACATGACACAGACGA
ACTTACTGCCAGCTAGTGTATTGGAAGTGTTATTGAAGAG
CAACACAAAACAATGCACAGAAGTATAAATGCATGACTAC
GCACAAGGTAGGCACCGTGGATAACGCCAAACACTCGACG
CAGAAGTATAAATCAGCCTTAAGGCCTTATCGGATTTGTC
AAATTTGGATAAACAACCAATGCATAAAATATATGCAATT
TATTACTCATGTCTGTGATATGAACTGTATATTGAATATA
CTGTTATCGCAATAATGACATTGTACAGCACGTCTTGGTA
CACAGCCTTGTACATTTGTCTTTTTGGCTGATTTTTGCAT
GCATCTTTGCCTCAAATCAAAGATTTGTATCTTGTTGGTT
TGTTTGTTTTTGTAAATATTAAATTAAAATTAATTCTAGC
ACCACACTAATCAAAAAGTGTTTAAGGACTATTTGCGGAA
AAACAAACCTCAGAATCGAGCATTCGAGCAATTCAAAGTG
TTGTGTAATCCTGAGTTGCCAGGTTTTTTACAACAAAACT
ATATCAATATCCTGCAAAAAAATTGCCAAACACTATCCCA
ATAATTCAATAATATCAAAAACTCCTATCTTATTCTTAAA
ACACAGATTATACATCACTGTATGCATTTTGAATGGTTTC
TTCTTTTAAATCGTTATTTTTTTGAATATCTATTTATTGA
ATTTTTTGCATTTACAATGTAAAGTATTACATTACCCCTA
CCCTACCACAACCACACATTGAAAGAAAAAAAAGGGGACA
AAAGATAAAAAATAAAATATACATCATTCCAGAGTGAGAA
AGCAGAGTGTTCCATATTTGTTCAGTCCATATGTTATCAT
TCAACATAAGAGGCTTGGCAACATCCAAAAGAAGGAATAT
ACAAAAGAGGGGCATCTTGATACAAAAAAAATAAAAATAA
ATGAATAAAATTTAAAAATTAAAATTCAATAATAAGAAAT
AAAAAAAAATTATAATGAAAAACTAAACGGTTATAATCCT
CTTAAATTACAAAACCTTCCAGATATATCAAAGTTGACAG
TGAGGCAATACCTTGTCATATTTTTAGTCAATATGTAATT
ATTTGACATGAAAAGTTTGGTAACATCCAAAGAGTACAAA
ATAGAAGTAACATAAAAAATAAAATAAATAGATAATTTTT
TTATAAAGGCCAGGGAGTTCTTCAAAATATTTCTTTAAAT
TAACTGTATAGTAATATTCTGTTCCATCCAGCAAAAAAAA
AAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations