header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-494
Transcript Name: serpinh1b-004
Previous Name: hsp47-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057540 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057540|OTTDARG00000020801|ZDB-GENE-990415-93 serpinh1b|no_translation hsp47-004 LG_ BX537138.6 Danio rerio protein_coding KNOWN, 1130 bp
CTAATATTCAACATTAAGCACATTTCAGAAATGCCTAAAA
AACAGGCTCATGTTTAAGGGATAATTCACCACAAAAAAAA
AAGGTATTTGCTGTTAATTTACTCACCCTAGTGTCCATCA
AAGACAAAGCTGACTGAAACATATTTTAATAAAAAATTTA
GCAGTCAACAGCTCCTAGCACTTTGAGAGTAAAAACCATA
TACAGGTAAAATAAAGGTAATACCCATGGCTCTTGAAAAC
ACCTTAAGGTCAGTTTGTTCAGGAATTTACAACCTTATTA
TATTTAATCTTTACAATCTTTGATCAGCCTCTGTGTTGTG
TCTTGAATGAATTAATGATAGGCTAGACTCTAGAGCAAAA
GCTTCCAGTTGTTTTGTTTTTGGGTGAACTATCCCTTTAA
GCAGCACATTCCCGTGAGATTAGTCTACGCCGCTGCTATT
GTTTAACTGGTCTAGAAAACATGACCTACAGGTTTAATTT
CTGTAGGTTTACCAATTTACAATACAAAGACTTAAATAAA
AGTGATAAAAAACATTAAAAAACACTAGTTTGCAGCCTTT
TGTTTCTATAAAACTGACACATGAAATATTAAAATTAGCC
TTTATATTGTACAACTGCTTTGGTCTAAAAAAAAAAACAT
AACCTACAGCCTTAATTTCTGTAGGTTTACCAATTTAGTT
TGCAGCCTTTTGTTTCTAAATCTGACACATGGAATATTAA
AATGAGCATTTCTGATAAATTGGGCAATTTGCACTAAGTA
TCACTTGTAATCTCTCTGCTATAGGCTTTTCGTATCCAAA
AATCCAGCCAGAATGTGGGTATCCAGCCTCATTGCTCTGT
GCCTTTTGGCTGTGGCCGTGTCCGGTGAGGACAAAAAGTT
GAGCACTCATGCAACCTCCATGGCAGACACCAGCGCCAAT
CTGGCCTTCAATCTCTACCACAATGTGGCTAAAGAAAAGG
GTCTCGAGAACATCCTCATCTCACCTGTGGTGGTGGCATC
TTCTCTTGGTATGGTGGCAATGGGAAGCAAGTCCTCCACT
GCATCCCAGGTGAAGAGCGTCCTGAAGGCTGACGCTCTGA
AAGACGAGCATCTGCATACGGGCTTATCAGAGCTTCTGAC
TGAGGTCAGT

serpinh1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA serpinh1b-201 (1)    Ensembl 2084
serpinh1b-204 (1)    Ensembl 848
ncRNA serpinh1b-003 (1)    Ensembl 804
serpinh1b-004 1130
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
serpinh1b-004 Contained in:
[BAC] DKEY-52L18 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000057540 (1),  Ensembl_Trans:ENSDART00000152365 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT648895 (1) 850 bp
GenBank:CT594111 (1) 810 bp
GenBank:CT677409 (1) 727 bp
CITATIONS (2)