header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8858
Transcript Name: serpinh1b-003
Previous Name: hsp47-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026165 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026165|OTTDARG00000020801|ZDB-GENE-990415-93 serpinh1b|no_translation hsp47-003 LG_ BX537138.6 Danio rerio protein_coding KNOWN, 804 bp
CCCACTGGGATGAGAAGTTCCACCACAAGATGGTTGACAA
CCGTGGTTTCCTGGTGACCCGCTCTCACACAGTCTCTGTC
CCAATGATGCATCGCACAGGTACTGTAAACCCAACAGCCT
GTTGTCTCCTATTAAAAAGTCAATAATATCCACATAGGTA
TTTAACAGTTCTCGTCTTTTACAGGAATCTACGGCTTCTA
TGAAGACACGGAGAACAGGTTTCTAATAGTCAGCATGCCT
TTGGCGCATAAGAAGTCCAGCATGATTTTCATCATGCCGT
ACCACGTGGAGCCTCTGGATCGGCTGGAGAATCTTCTCAC
CCGCCAGCAGCTGGACACCTGGATTAGCAAACTTGAGGAG
AGAGCGGTCGCCATCTCTTTGCCCAAAGTGAGCATGGAAG
TCAGCCACGACCTTCAGAAACATCTTGGAGAACTCGGTCT
CACTGAAGCTGTGGACAAGTCTAAGGCAGATCTGTCCAAC
ATTTCCGGCAAGAAAGACCTTTACCTCTCCAATGTCTTCC
ATGCCTCCTCCTTGGAGTGGGACACAGAGGGAAACCCATT
TGACCCCAGCATTTTCGGCAGTGAGAAGATGAGGAACCCC
AAGCTCTTTTACGCCGACCATCCCTTCATTTTCCTTGTGA
AAGACAACAAGACCAACTCCATCCTTTTTATTGGCAGGCT
AGTTCGCCCTAAGGGTGATAAGATGAGAGATGAATTGTAA
CTTTTAGGCTATTTGAATGAACTTTTGGAAATTTATTTTT
TATTATTATTTTTTTTCAAACTGTTATTATTGTAATTAAT
GGTG

serpinh1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA serpinh1b-201 (1)    Ensembl 2084
serpinh1b-204 (1)    Ensembl 848
ncRNA serpinh1b-003 804
serpinh1b-004 (1)    Ensembl 1130
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
serpinh1b-003 Contained in:
[BAC] DKEY-52L18 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000026165 (1),  Ensembl_Trans:ENSDART00000133845 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT711276 (1) 792 bp
CITATIONS (2)