Transcript

noc3l-203

ID
ZDB-TSCRIPT-121213-490
Name
noc3l-203
Previous Names
  • noc3l-003
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057476 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057476|OTTDARG00000027331|ZDB-GENE-030131-9878 noc3l|OTTDARP00000045050 noc3l-003 LG_ CU459118.5 Danio rerio protein_coding KNOWN, 2565 bp
CTGTCCATGTGGTGCGTGTTTGAAGAGTGGATTCATGCAC
TCTTCAGTTTTAGGATTAAACTGAATCACACGTTTGAATT
ATTGTCGACCTTAAGTCAAATCATCGCTCAAAATGGGCCC
GGCTTCTAAAAGAAACAAGAAAAAGAGGCCTAGCTTCAGA
AAGTTACTGAAAACCAGTAACCTGAAGCTAGAAAACAAAC
TGAAGAATCGGCAGTTTAAGCAACAGAGTTCGGCTAAAAA
ACAACGCAAAGAGCAGAGGAAACTCCACAAGGCCATTTCT
GATGTTTCCCATCAGACCCTCAAACCCCTGGAGCGCTACA
AGAAGAGACCCGAGGATGAAGAGGAGGAGGAAGAGTTCCT
GGAGTCTCTGCCCACAGATATGATGGATGAAGATGATCTG
GAACACATCAGAGCCATCGCACAGAAAGCCTCTTTTCTGA
CCCGCGACCTCTCTTCATGTGCTCCAGTACATGCCAAAAA
GCATAAGTCTGAGCAGGCGCTGGAGAATTATGAGAAGATG
CCCAGAAAGATGCAGCAGGAGGAAGAGAAAGAGCTTATTC
ACTTGCTGCCCATCAAAGACAAGAGTGGCCTGATCCCTCA
GAGCATGGAGAAACCTGTTTTACCACAGGCAGAAGAAGAA
GAAGAGGAACCAAACCAGGAGGTTTACTTACAAAAAGAGG
AGGAACCAGAGAGCGCTCCATTGCTAACACCTCAGGAGCA
GTTTGAGCAGCGCGCACAGAAACTGATGGAGAAGAAACTG
CGCATCGCCGCTCTGTCCTCTGCAATACTGGCAGATCCAC
ATGTTAATATCAAGAAGCTGAAGGAGCTGAGGGCCATGCT
GATGGAGACAGACCCCTGCGTTGCCGTCACCGTCAGAAAG
TTAGTCATGGTCTCCCTCATGGAGGTCTTTAAGGACATTG
TGCCGGCATATCGAATCCGACCTCTGACGGAAGAAGAGAA
GGCCGCAAAGGTGAAGAAAGAGACGCTGCAGCTCAGAGAG
TTTGAGGAGGGTCTGGTCAGCCAGTATAAGTTTTACCTGG
AGGAGCTGGAACAGACAGTCAAAGACTGGAAGCAGAAGAA
GGAGAAGAGAAGTCAGGCCGTGTCTCTGCAGTCCTACAAG
GGTCTTGCTGAAGTGGCCGTGCGCTGCATCTGTGAGCTGC
TGGTTGCTCTGCCACACTTCAACTTCCACAACAACATTAT
AGTCATGCTGGTGCCTTTGATGAATGACTCCGACAAGAAG
GTGTCTGAGATGTGTTGTGAAGCTGTAAAGAAGCTGCTGA
AACAGGATAAAGTGGGCCAGGCCTCGTTAGCCATGGTCAA
GGTGATCTCAGGAATGGTCAAGAGCAGGAACTATAGGATC
AAACCAGTGGTGCTGAACTGTCTTCTGTGTCTGAGAATAA
AAGAAGTGGACATGAAGAAAGACACTGAAGATACTGCACC
CAAAAAAAAGTTCATGTCATTCAAGGAGAAGAGGAAAAAT
TTATCCAGGATGCAGCGGAAGTGGAAGAAAGCAGAGGAGA
AGCTGCAGAAGGAACTGCTGGAAGCTGAAGCTACAGAGAG
CAAGGAGAAGAAAATTAAACTGCACACAGAGACGCTGAAC
GTCGTGTTCTTAATCTACTTCAGGATACTGAAGAAAGCTC
AGAAGTCCGTCTTACTGTCCTCCGTTTTAGAAGGTCTTGC
AAAGTTTGCTCATCTGATAAACCTGGAGTTCTTTGATGAT
TTGTTAGCCGTGTTGTACAACCTCATCACATCAGGGGATC
TGACGTATCGCGAGAGTCTCCACTGCATTCTCACGTCCTT
CCACATCCTTTCAGGACAAGGTGACGTCCTCAACATTGAC
CCCCTGAAATTCTACAGCCACTTGTACAGAACGCTGCTGA
CGCTACACGCAGGAGGAGTGAATGAGGACACTGTGATCGT
CCTGCAGTGTCTGGACGTGATGCTGTCCAAGCGCAGGAAG
CAGGTGACGCTGCAGAGAGCGCAGGCCTTCCTCAAGAGGC
TGAACACTGTGGCTCTACATCTGCTGCCAGACTCGTGTGT
GGGCATTCTGGCTGCTAACAGGATGCTGATACCTTCCCCA
AGTGTGACATCCTTCTGGATAATGAGACGCAGGGCAGTGG
TGTGTATCTGCCAGAGCTGGACGTGCCTGAATACTGCAAC
CCGCAGAACACAGCACTCTGGGAGCTGCACTTACTCAAGA
GCCATTATCATCCCGTGGTGAGGAAGTTTGCAGCTCATCT
GATGAAGGGAGCTCCTAGTGAAGGATCTGGTGCTCTGGGT
GTGGAGCTCAGCAGAAGGTCTCCGTTACAGCTCTTTGAAG
ACTACAGTGTGAAAGACATGAGCTTTAACCCACCTGTTGC
AGGACCACCTTCCAAGAAAAAGGAGTATTTCACCATCGGT
CATGCATTCTTACATAGTGAGCTGAGTCGTCAGATTGATG
CCGCTCTTCAGGAGGAACCTGAACAGATGAGTCTAGACTT
CACATCACCACACACACAGCAGGAACCATGAACAGATGAT
TACAGTATGGTGTAAAATAATAAATGATATCCGCTTTGAT
TTCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations