Transcript

noc3l-201

ID
ZDB-TSCRIPT-090929-17150
Name
noc3l-201
Previous Names
  • noc3l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036701 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036701|OTTDARG00000027331|ZDB-GENE-030131-9878 noc3l|OTTDARP00000029440 noc3l-001 LG_ CU459118.5 Danio rerio protein_coding KNOWN, 2569 bp
CTGTCCATGTGGTGCGTGTTTGAAGAGTGGATTCATGCAC
TCTTCAGTTTTAGGATTAAACTGAATCACACGTTTGAATT
ATTGTCGACCTTAAGTCAAATCATCGCTCAAAATGGGCCC
GGCTTCTAAAAGAAACAAGAAAAAGAGGCCTAGCTTCAGA
AAGTTACTGAAAACCAGTAACCTGAAGCTAGAAAACAAAC
TGAAGAATCGGCAGTTTAAGCAACAGAGTTCGGCTAAAAA
ACAACGCAAAGAGCAGAGGAAACTCCACAAGGCCATTTCT
GATGTTTCCCATCAGACCCTCAAACCCCTGGAGCGCTACA
AGAAGAGACCCGAGGATGAAGAGGAGGAGGAAGAGTTCCT
GGAGTCTCTGCCCACAGATATGATGGATGAAGATGATCTG
GAACACATCAGAGCCATCGCACAGAAAGCCTCTTTTCTGA
CCCGCGACCTCTCTTCATGTGCTCCAGTACATGCCAAAAA
GCATAAGTCTGAGCAGGCGCTGGAGAATTATGAGAAGATG
CCCAGAAAGATGCAGCAGGAGGAAGAGAAAGAGCTTATTC
ACTTGCTGCCCATCAAAGACAAGAGTGGCCTGATCCCTCA
GAGCATGGAGAAACCTGTTTTACCACAGGCAGAAGAAGAA
GAAGAGGAACCAAACCAGGAGGTTTACTTACAAAAAGAGG
AGGAACCAGAGAGCGCTCCATTGCTAACACCTCAGGAGCA
GTTTGAGCAGCGCGCACAGAAACTGATGGAGAAGAAACTG
CGCATCGCCGCTCTGTCCTCTGCAATACTGGCAGATCCAC
ATGTTAATATCAAGAAGCTGAAGGAGCTGAGGGCCATGCT
GATGGAGACAGACCCCTGCGTTGCCGTCACCGTCAGAAAG
TTAGTCATGGTCTCCCTCATGGAGGTCTTTAAGGACATTG
TGCCGGCATATCGAATCCGACCTCTGACGGAAGAAGAGAA
GGCCGCAAAGGTGAAGAAAGAGACGCTGCAGCTCAGAGAG
TTTGAGGAGGGTCTGGTCAGCCAGTATAAGTTTTACCTGG
AGGAGCTGGAACAGACAGTCAAAGACTGGAAGCAGAAGAA
GGAGAAGAGAAGTCAGGCCGTGTCTCTGCAGTCCTACAAG
GGTCTTGCTGAAGTGGCCGTGCGCTGCATCTGTGAGCTGC
TGGTTGCTCTGCCACACTTCAACTTCCACAACAACATTAT
AGTCATGCTGGTGCCTTTGATGAATGACTCCGACAAGAAG
GTGTCTGAGATGTGTTGTGAAGCTGTAAAGAAGCTGCTGA
AACAGGATAAAGTGGGCCAGGCCTCGTTAGCCATGGTCAA
GGTGATCTCAGGAATGGTCAAGAGCAGGAACTATAGGATC
AAACCAGTGGTGCTGAACTGTCTTCTGTGTCTGAGAATAA
AAGAAGTGGACATGAAGAAAGACACTGAAGATACTGCACC
CAAAAAAAAGTTCATGTCATTCAAGGAGAAGAGGAAAAAT
TTATCCAGGATGCAGCGGAAGTGGAAGAAAGCAGAGGAGA
AGCTGCAGAAGGAACTGCTGGAAGCTGAAGCTACAGAGAG
CAAGGAGAAGAAAATTAAACTGCACACAGAGACGCTGAAC
GTCGTGTTCTTAATCTACTTCAGGATACTGAAGAAAGCTC
AGAAGTCCGTCTTACTGTCCTCCGTTTTAGAAGGTCTTGC
AAAGTTTGCTCATCTGATAAACCTGGAGTTCTTTGATGAT
TTGTTAGCCGTGTTGTACAACCTCATCACATCAGGGGATC
TGACGTATCGCGAGAGTCTCCACTGCATTCTCACGTCCTT
CCACATCCTTTCAGGACAAGGTGACGTCCTCAACATTGAC
CCCCTGAAATTCTACAGCCACTTGTACAGAACGCTGCTGA
CGCTACACGCAGGAGGAGTGAATGAGGACACTGTGATCGT
CCTGCAGTGTCTGGACGTGATGCTGTCCAAGCGCAGGAAG
CAGGTGACGCTGCAGAGAGCGCAGGCCTTCCTCAAGAGGC
TGAACACTGTGGCTCTACATCTGCTGCCAGACTCGTGTGT
GGGCATTCTGGCTGCTAACAGGATGCTGATGCAGACCTTC
CCCAAGTGTGACATCCTTCTGGATAATGAGACGCAGGGCA
GTGGTGTGTATCTGCCAGAGCTGGACGTGCCTGAATACTG
CAACCCGCAGAACACAGCACTCTGGGAGCTGCACTTACTC
AAGAGCCATTATCATCCCGTGGTGAGGAAGTTTGCAGCTC
ATCTGATGAAGGGAGCTCCTAGTGAAGGATCTGGTGCTCT
GGGTGTGGAGCTCAGCAGAAGGTCTCCGTTACAGCTCTTT
GAAGACTACAGTGTGAAAGACATGAGCTTTAACCCACCTG
TTGCAGGACCACCTTCCAAGAAAAAGGAGTATTTCACCAT
CGGTCATGCATTCTTACATAGTGAGCTGAGTCGTCAGATT
GATGCCGCTCTTCAGGAGGAACCTGAACAGATGAGTCTAG
ACTTCACATCACCACACACACAGCAGGAACCATGAACAGA
TGATTACAGTATGGTGTAAAATAATAAATGATATCCGCTT
TGATTTCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations