Transcript

noc3l-002

ID
ZDB-TSCRIPT-090929-17151
Name
noc3l-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036702 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036702|OTTDARG00000027331|ZDB-GENE-030131-9878 noc3l|no_translation noc3l-002 LG_ CU459118.5 Danio rerio protein_coding KNOWN, 603 bp
GTGTGCGTGCGTGCCTGTGTGTGTGTAAAATGCTGTCTTC
TTCTGGTGAAATTTGTTCTGGTATTCTGGGTAAATACATT
CAGTAATGATGTCATAGAAAGCATCTAGACCCAGTTTTGC
AGAAAATCTGTGGCATTTCATAAAAAAATGTGAGATCTGC
AAAATTTTGTGTAGTTTGCTTGTTTTTGTGATAAATTCAG
CAATCTCAAAATCCTGGAAGGACTGTAAACGAAATGAGAC
CTTCTCCAAAACAAAAAAATATAATAGGAAATACTGTAAA
AATTTTCTTGCTCTGTTAAACAGCACTTGGGAAATATTTG
AAGGATTGGACAGGAGGGCTAATCATTTTGTCTTCAATTG
TGCTTGAAACAATTCGTTTTAAGGAATACCTGTGGAAGTA
CCATTTGTGCTGGTGTTGTTTGTGTCTGTTCAGGTGTCTG
AGATGTGTTGTGAAGCTGTAAAGAAGCTGCTGAAACAGGA
TAAAGTGGGCCAGGCCTCGTTAGCCATGGTCAAGGTGATC
TCAGGAATGGTCAAGAGCAGGAACTATAGGATCAAACCAG
TGGTGCTGAACTGTCTTCTGTGTCTGAGAATAAAAGAAGT
GGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations