Transcript

dis3-201

ID
ZDB-TSCRIPT-121213-45
Name
dis3-201
Previous Names
  • dis3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047347 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047347|OTTDARG00000033634|ZDB-GENE-080213-3 dis3|OTTDARP00000037203 dis3-001 LG_ BX571717.12 Danio rerio protein_coding KNOWN, 3247 bp
CACTGTGTGCTGTGTTTTGGTGGAACAGCTCTTCAAAACC
GCTTGACCATTAGCTTGACCATGTTGAAGTCCAAAACATT
TGTAAAAAAGACCCGTTCTGGCGGAGTGTTGAAAATCGTA
CGGGAACATTATCTCCGAGATGACATCTGGTGTGGAAGTG
AAGTTTGTAAGGAGTGCAAAGATGAAGCTCCGGTGCTGCA
AGAAGAAACTTGTATAGAAAGCAACCTCTGCCCATATCCT
CACTATTTAATCCCAGACACCAATGTGGTTTTACATCAGA
TCGATATCCTTGAGGACCCTCTGATCAGGAACGTCATTAT
TCTTCAGACCGTTTTACAAGAGGTCAGACACAGGAGTGCA
CCAGTTTACAAAAGAATCAAGGATGCTATTCACGAAAAGG
AAAAGCACTTTTACACCTTTACAAATGAGCACCACAGGGA
GACATTTATTGAGCGAGAGCAAGGTGAAAGTGCTAATGAT
CGCAATGATCGAGCCATCCGTGTCGCTGCTAAATGGTACA
CTGATCACCTTGCTAAGGCAACTGATGGCGGGACACTGAA
AGTGGTTCTGTTGACCAATGACCGGGCCAATAAAGAAAAG
GCAGAGCAGTTTGGTCTTACTGTGTACAGATGTGAAGAGT
ATATCAAGAGTTTGGTTGGCAACCCTGAGCTTGTGGACAG
GCTTGCAATGACATCTGATGATCAAAATGAAATCACTGGC
AGTAAGTTACTCTTTCCAGAGCACCTGCCCTTATCCAGGA
TTCAGACTGGCATCAAGAATGGAGTATTCATTCAGGGTAC
ATTTCATGCCAACCGTGATAACTATCTGGAGGGGACAGTC
TTTGTAAATAGAGAGGGGGAGGATATCAATGAGATTCTAC
TTCAAGGCCTTCAGAATTTAAACCGGGCTGTGAATCAAGA
TGTAGTGGCTGTTGAACTCTTTCCAAAAGACCGCTGGGTT
GCTCCATCATCTGTCGTCCTTCAGGATGATAATTTAAATG
ATGAAGATACTGAAGAAGATGAGAATGACAGTAAATTGAA
GAGTGTAGCATCAGAGTCTAGTGTCCTAAAACCCACAGGA
AGAGTGGTGGGCATCATAAAGAGGAACTGGAGGCCTTTCT
GTGGGATGCTTGCACAGTCACAGATCAAAGAGGCAACAAG
ACACCTTTTCACTCCAGCAGACCGGAGAATCCCACGAATC
CGCATTGAAACCAGACAAGCTGCCACACTGATTGGACAGA
GGATTATGGTTGCTATAGATGGATGGCCTAAAAACTCAAG
ATACCCAAACGGTCACTTTGTGAAAAACCTTGGCACTGCT
GGAGATAAAGAGACAGAGACCGAGGTGCTTCTTCTAGAGC
ATGATGTTCCTCACCAACCCTTCTCTCAGGCTGTTCTCAG
TTTCCTTCCCAAGATGCCCTGGGGTATTACAGAGGAGGAC
CTGAAGGTCAGGGCAGATCTCAGACATCTCTGTGTGTGCA
GTGTGGATCCTCCTGGATGTACAGATATTGATGATGCTCT
TCACTGCCGGGAACTGGAGAATGGAAATTTGGAGGTTGGT
GTTCACATAGCAGATGTCAGCCATTTTATTCGGCCAGGGA
ATGCACTAGACCAAGAGGCTGCAAACAGAGGCACCACAGT
TTACCTTTGTGGAAAGAGAATAGACATGGTTCCTGAACTT
CTGAGTTCCAACTTGTGCTCACTGCGGTCCAACGTTGAGA
GGTTGGCATTCTCTTGTATTTGGGAGATGAATCATAAGGC
TGAAATCATCAAAACTCACTTTACAAAGAGTGTCATTAAC
TCAAAGGCCTCACTTACATATGCAGAAGCTCAGATGAGGA
TTGATGACACCACCATGAATGACGACATCACAAAGAGCCT
TCGGGGCCTTAACAAATTGGCTAAGATCTTAAAGGCCCAG
AGAATTGACAAAGGAGCGCTGACACTCTCATCTCCTGAAG
TACGCTTCCACATTGACAGCGAAACGCATGACCCTATAGA
TCTGCAGACCAAAGAACTAATGGAGACTAACTCTATGGTA
GAGGAGTTCATGTTGTTGGCGAATATCTCAGTAGCTCAGA
AGATCTATGATGAGTTCTCAGAATGTGCTCTGCTGAGGAA
ACATCCTGCACCGCCACCGTCAAACTACGACATCCTCATC
AAGGCTGCAAAGTCCAGGGATCTGGAGATCCACACAGATT
CCGCCAAAGCTCTGGCCGATTCCCTAAACAATGCAACGAT
TGAGAACTTTGCATATTTCAACACTCTTCTGAGGATTCTG
GCCACCCGCTGCATGATGCAGGCTGTGTATTTCTGCTCTG
GCATGGACAGTGATTTCCACCACTATGGCCTGGCATCACC
TATTTACACACACTTCACCTCACCCATCAGAAGATACGCT
GATATCATCGTTCACCGTCTGTTAGCAGTGGCTATTAATG
CAGACAGCACATACCCTGATTTGATGGACAAGCATAAGCA
GTCGGCCTTATGCAACAACATCAACTACAGACATAAAATG
GCCCAATACGCACAGAGAGCCTCAGTGGCCTTCCACACTC
AGCTGTTTTTCAAGAATAAGGGAATCATAAATGAAGAAGG
CTTTATTCTGTTTGTGAGAAAAAATGCCATCATCATCCTC
ATCCCTAAATTTGGTTTGGAGGGGACCGTGTTCTTTGAGA
ACAAGGACAAACCCAGTCCTCGTCTCAGCTTTGACACGGA
GGGTCCTACGCTTAAAGTGGAAGAACACACTTTCCGCATC
TTTGATCGAGTCAAAGTCACAATTAGTCTTGATGCTTCCA
ACTTGCAGCACCAAAGGATCAGAATGGCGCTCACTGAGCC
TGTGATCCCTGGTGTCAGTGTACCCATCCCTGAATCAGAA
CCAGAGGCCAAAAAACCCAAGCTTGACCGTTGATATACGA
GCATTTAAAGCTATCATACTACTTTATATAAATGCTAACT
TTTGCTTTCAGCTCATCTACAAGGTAGTTTCATGAAGACC
TTGAGTTAACACCTAAAGCAGTAAAATGGACACAAATGGG
TTTTTAATAGTTTTTTTTATAATTATTGAATGCATCCTGT
ACTGTTTTTGCTCTTGATTCTCTTCTCTCTCTTTTTTTTT
TTTACTAATACACAATTTTTATCTGTTAGAAACGATCAAT
AGCACTGGATCAACAGTGAGGAGTCTTTCTGTTGGTTTCA
TTGTCATTGAAAACAGAACATCAATATTAAACAGACTTTT
GAAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations