Transcript

dis3-002

ID
ZDB-TSCRIPT-121213-356
Name
dis3-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047348 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047348|OTTDARG00000033634|ZDB-GENE-080213-3 dis3|no_translation dis3-002 LG_ BX571717.12 Danio rerio protein_coding KNOWN, 757 bp
TGTGTTTTGGTGGAACAGCTCTTCAAAACCGCTTGACCAT
TAGCTTGACCATGTTGAAGTCCAAAACATTTGTAAAAAAG
ACCCGTTCTGGCGGAGTGTTGAAAATCGTACGGGAACATT
ATCTCCGAGATGACATCTGGTGTGGAAGTGAAGTTTGTAA
GGAGTGCAAAGATGAAGCTCCGGTGCTGCAAGAAGAAACT
TGTATAGAAAGCAACCTCTGCCCATATCCTCACTATTTAA
TCCCAGACACCAATGTGGTTTTACATCAGATCGATATCCT
TGAGGACCCTCTGATCAGGAACGTCATTATTCTTCAGACC
GTTTTACAAGAGGTCAGACACAGGAGTGCACCAGTTTACA
AAAGAATCAAGGATGCTATTCACGAAAAGGAAAAGCACTT
TTACACCTTTACAAATGAGCACCACAGGGAGACATTTATT
GAGCGAGAGCAAGGTGAAAGTGCTAATGATCGCAATGATC
GAGCCATCCTGTACCCATCCCTGAATCAGAACCAGAGGCC
AAAAAACCCAAGCTTGACCGTTGATATACGAGCATTTAAA
GCTATCATACTACTTTATATAAATGCTAACTTTTGCTTTC
AGCTCATCTACAAGGTAGTTTCATGAAGACCTTGAGTTAA
CACCTAAAGCAGTAAAATGGACACAAATGGGTTTTTAATA
GTTTTTTTTATAATTATTGAATGCATCCTGTACTGTTTTT
GCTCTTGATTCTCTTCTCTCTCTTTTTTTTTTTTACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations