ZFIN ID: ZDB-TSCRIPT-121213-301
Transcript Name: jag2b-003
Previous Name: jag2-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058175 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058175|OTTDARG00000005397|ZDB-GENE-011128-3 jag2b|no_translation jag2-003 LG_ BX004766.9 Danio rerio protein_coding KNOWN, 812 bp
GATCCTACACACTCATCCTTGAAGCTTGGGACTGGGATAA
CTCCACTCAGAACAATGGTGAAGAAAATTTGATCGAACGG
CACATTCACGCAAGCATGGTAAACCCCGGCGACCACTGGC
AGTCCATCCGGCACCCTGGCATCACGGCCCACATTGAGTA
CCGCATCCGTGTCAGGTGTGATGAGAATTACTATGGGAGT
AAGTGCAACAAACAGTGTCGCCCACGAGATGACTACTTCG
GTCATTACCGATGCGATCCATCTGGAAATATTGTGTGTCT
TGATGGCTGGATGGGAGAGGACTGTCGGACAGGTGGGTGA
CGTTGACCATCTTTGTTTTGTGCTTTGCATTTTAGTTTTA
AGTTATATACATTCATTCATTTTCCTTCGACTTAGTCCCT
TATCAGGGGTGGCCACAGCAAAATGAACCACCGACTATTC
CAGCATATATTTTACACAGCGGATGCCCATCCAGCCGCAA
CCCAGTAGTGGGAAAAAGTAATGAAGAAAACATGGATAAT
ATTCATACTTCAAGTTCTTTGTTATTATTTTGTCTGTGTA
AAAACACGTGACCAGTGTTTTCAATACTGTTACATACATT
GTAAAAATTATATGTTCAATTAGTCCTGACAGCATATGTT
TTTAGGTTATGGTAACTTATTAAAATAAGTTAATCATGTT
CTAATGTAATTTTATAAGTTTTGCAAGCTGTTTCAGATCA
GTTTAACACAATATAAGTTCAATGGACTCATAAGGTTAAG
GCCACCAGCATTGTTTTTATAGTGTATTATACTATTAACG
ATACTATTACAG

jag2b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA jag2b-003 812
mRNA jag2b-201 (1) 5438
jag2b-202 (1) 5324
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jag2b-003 Contained in:
[BAC] DKEY-5P1 (1) (order this)
OTHER jag2b-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058175 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT613680 (1) 818bp
    CITATIONS (1)