ZFIN ID: ZDB-TSCRIPT-090929-553
Transcript Name: jag2b-201
Previous Names: jag2-001, jag2b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005844 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005844|OTTDARG00000005397|ZDB-GENE-011128-3 jag2b|OTTDARP00000005228 jag2-001 LG_ BX004766.9 Danio rerio protein_coding KNOWN, 5438 bp
GTGATCAGACCGAGGGAGAGATCAGCACAGACCATCACCG
CGCAAACACACCACGCTCGTGAATTTTTGCATGTCAGGAA
CGGAGGATCCTGTCGCCGGTCATCGGCCGTTTTCCATCTT
GCGTTTATAACACATCAAATCGGCGGCATGTGGAATTGTA
TCAGGATTAGGAATTGGCTCCCAATCGCGTGCCTGCTGTT
AACGATGTGGACGAAGGTGTCCCAGTCCTCTGGCTATTTT
GAGCTGCAGCTGATTGCTGTAGAAAATGTAAACGGTGAGT
TGTGGGACGGGGAATGTTGCGACAGCACGCGGAACTCTCA
AGACCAGCGCTGCGTGCGGGACGAGTGCGATACTTACTTT
AAAGTGTGTCTGAAGGAGTACCAGTCTGAAGTCACCACCA
CTGGACAGTGCACCTTCGGCTCTGGATCTACCGACGTTCT
TGGTGGAAATATAATTTCTTTTAAGACCGCAAAAAACAGC
CCCAGCAAAACGAGCGACGTGGGAAAGATCATCATCCCTT
TTCACTTCGCCTGGCCGCGATCCTACACACTCATCCTTGA
AGCTTGGGACTGGGATAACTCCACTCAGAACAATGGTGAA
GAAAATTTGATCGAACGGCACATTCACGCAAGCATGGTAA
ACCCCGGCGACCACTGGCAGTCCATCCGGCACCCTGGCAT
CACGGCCCACATTGAGTACCGCATCCGTGTCAGGTGTGAT
GAGAATTACTATGGGAGTAAGTGCAACAAACAGTGTCGCC
CACGAGATGACTACTTCGGTCATTACCGATGCGATCCATC
TGGAAATATTGTGTGTCTTGATGGCTGGATGGGAGAGGAC
TGTCGGACAGCGATCTGCAAGCAGGGCTGTAATCTGATTC
ACGGAGGCTGTGCGGTGCCTGGAGAATGCAAGTGCAACTA
CGGCTGGCAGGGGCAGTTCTGCGACGAGTGTCTACCTTAT
CCTGGCTGTTTGCACGGTACCTGTGTTATGCCCTGGCAAT
GCACTTGTGAGAAGAACTGGGGCGGCCTCCTCTGCGATAA
AGATCTGAACTACTGCGGCACGCATCATCCTTGTGTCAAT
GGTGGAACCTGCATGAACTCTGAACCGGATGAATATAACT
GTGCCTGTCCCGAAGGCTACTCTGGCAAGAACTGTGAGAT
AGCTGAACATGCATGCGTATCAAACCCCTGTGCAAACGGA
GGCACGTGTCATGAAGTCCCGACCGGATTCGAGTGCCACT
GTCCACCAGGCTGGGAGGGTCCCACTTGCGCTAAAGACAT
GGATGAATGTGCCTCCAGCCCGTGTGCGCAAGGCGGAACA
TGTATCGACCTGGAAAATGGCTTTGAGTGTGTCTGTCCTC
CGCAGTGGGTTGGAAAGACCTGTCAGATCGATGCAAATGA
GTGTATGGGGAAGCCTTGCGTAAATGCTCACTCTTGCAAA
AACATGATTGGTGGATATCACTGTGACTGCTTTCAAGGAT
GGGCCGGACAGAACTGTGACATCAATCTCAATGGCTGCCA
TGGACAGTGCCAGAATGGAGCTACTTGCAAGGAGCTGGTT
CATGGAGGTTACCACTGTCAGTGTCCTGCGGGGTTTGTGG
GCTTACACTGTGAAGTCTCAAGGAATAAATGTGCCAGCGG
TCCATGTCAGAATGGTGGCCGCTGCCATGTCATTCTGGAC
AGCTTCGTTTGTGAGTGTCCGTCAAACTACGCAGGGATGC
TCTGTGAGGTGGAGAGTCTGTCTCACCCAAACCCATGTGA
GCCGAACCCTTGTCAGAATACAGCTTTGTGCTACAGTCTG
CCGGGTGACTTTTACTGCGCCTGTCCTGAAGACTATGAGG
GCAAGACCTGCGAAAACCGCAAGGACCACTGCAAGATGAC
CCCTTGCCAAGTGATCGATAGCTGTACCATTGCTGTGGCG
AGTAACAGTTCAGATGGAGGCGTGAGACACATTAACTCTA
ATGTTTGTGGTCCTCATGGCCGCTGTATCAGTCAGCCGGG
TGGAAATTTCACCTGCACCTGTGAGCTTGGCTTTACAGGA
ACCTACTGTCACGAGAATGTAAATGACTGTGTGAGCAATC
CGTGTCGAAATGGAGGCACCTGTATTGACGGGATCAGCTC
TTTCCAGTGCTTCTGTCCAGATGGCTGGGAAGGAGACCTT
TGCAGCATCAATGTGAACGAGTGCAGTCGGAGCCCCTGCA
AAAATGGCGGGCACTGTGTGGATCTGGTCAATGACTTTTA
CTGTGAATGTGCCAATGGCTGGAAGGGAAAGACCTGCCAT
TCACGTGAAAGTCAGTGTGACTCCTCCACATGCAGTAATG
GAGGAACCTGCTATGATCACGGAGATGCTTTCCGCTGTGC
TTGTCCTCCAGGATGGGAAGGAAGTACATGCAATACAGCG
AAGAACAGCACTTGCGCGTCCGGCCCCTGTCTGAATGGAG
GCACGTGTGTGGGTGGCGGAGACACGTTCACCTGCATCTG
TAAAGACGGCTGGGAGGGAGCCACCTGCGCCCAGAACACC
AACGACTGCAACCCTCACCCCTGTTACAATGGAGGAATCT
GTGTGGATGGGGTGAACTGGTTCCGCTGTGAATGTGCTCC
TGGATTTGCAGGACCCGACTGCCGTATCAACATCGATGAG
TGCCAGTCATCCCCCTGCGCCTATGGTGCCACCTGTGTGG
ATGAGATCAATGGTTTCCGGTGTGTTTGCCCACTCGGTCG
CACTGGACCTCAATGCCAAGAGTTTATTGGCATTGGGAAG
ACGTGCCACTATGCTGGACTTCAGTTCCCACATGGCAGCC
GCTGGGAGGAAGAATGCAACACTTGTCAGTGCGTCAACGG
CAAGGTGGAGTGCACCAAGGTGGTCTGTGGTCGGAAGCCA
TGCCTTCTGCCAGGGACCCCAGGGCGAGAGCTTCACTACT
GTCCAGGAGGTCGTGAATGCCTGGAGCACAACTTCCTGAC
ATGCCTCTCACCCCCTTGTCACCAATGGGGGTTTTGTTCA
AGCCCTGAGACCCCCCCAACCCTCCAAACCAAATGCGAGC
CCAACTCGGTCTATCTGGACAAGAGCTGTGCTCGCATCAC
CCTTATTTTCAACAGGGACAAACTACCCACAGGAACGACG
GTGGAGAATGTCTGCTCGGAGCTGAGGTATATGCCTGCCA
CGCGGAGCCTGGCAAAGGATCATAAGCTGTTGGTTCTGTG
TGACCTCTCCTACAAAAACCAGGACGCCGTAGAGGTAGCC
ATTTCGTTCCAGCAGGATGAGCAGCCCAGTCACAGTCAAA
TCCAGGAGGCTGCGAGTACCATCGTCAGCACACTGTCCAA
GCGGCACAACAGCACCGTCATGCTTGCCGTCATCGAGGTC
AAAGTGGAGATGCCGGTCACGTCTCAGCCAGTGGATTACC
TGGTACCTGTGTTGTGCGTCGTCTTATGCGTCCTCTGGGT
CTTCTGCGTCATCGTCTGTGTATGGTGGACCCGCAAGCGG
AGAAAAGAGCGCGAGAGATGTGAGCGCGTTCCAGTGGAGG
AGAGTGTCAACAACCAGTGGGAACCGCTGAGGCCTGTGAC
GCGGCCGCAGCACAAGGACAACCGGGACGCGCAGTTTGAG
CGCACCAAACTCATGGGCTCCCCAGACCGAACCTGCAACA
GCGGGGACGACGAGGAGGACATGGAGGAGGATGAGCTGGA
GCTGGTGGAAGAATGGTGCGGGACGGAAGGAGGCAAGCAT
CCCGTCCAAAAGTACTCTAAATCTGCAGCGCGGACCAAGA
ATGGGCTGATCTGCACCACGAGGAGCACCAGCGGCAGCAG
TAGCCCTTCACTCAAAGCAGCCTACTGGACAGGCTTCAGC
CCAAAGGACAACAACTGTAAAAATGTCAATAATGCCACCG
CCGGCCAAGAGCACAAAGAACACTGCGTATGAGCTCCGAT
GAGCAGGACGAGGAGACCAAGGCCATCTCAGAAACCAAGA
CTGAGTTTGTTTTTTTTCCCCCATGTGTTGTTTTATTTTT
GACTCTTTGGAGCGTTTTGAAGCTGAAAAAGTGGCAAATT
TCTTTCCCTTTTTTTTATGTACAGAGGAAGCAGACTGTAT
TTGTTTATAAGGAGGCATCGAGAAGCCTCGTTTTTGTTTT
CGGGAAGAAAAAAAAACTAAACTGCTGGAATGGAAGCAAG
ACTAAGGAACTTGCGAATTTTATGTTGTTGTTTACAAACA
TTTGTGCTTTTGATTTCGTTTCGAGTGGCCCAACTTCGGT
GCAGACCACGTGGGGACAAGCGTTCATCTGTTCTCCTTCC
GCGCCTGCCTTACAGAGCTCGACGTTCACGAGGAGGGCTA
GAGTGCCTATAAAGTGGCCTTGTTTTTTTTTCTGCCGACT
TGGCTGAACGCTCTTTAAACAAACGGATTGCAGTATTTTG
AGTCGTTCGCAAGTGCCTTCAGACAAGCCCCTCGGTTTCA
GGGTCTCCAGCCCCGGTAGATCACGAAAAACACACACACG
CACACACACAAAAAATAGGTGGAGAGGCTGGTCCCAAAAG
CAGCTCCCATATAACCATCAAGGTATTTGTTTAAAGACGA
GATCTGTAAATACGTGTAAATAATAAAGGAGTCGCTGTGT
ATATTTGAATTTAGTAACTTAAGTCACTTTTTTTATTATT
ATAATTATTATTATTATGATTTAAATATTATGATTATTAT
TGTTTTTTATTTTTATTTTCCACCATTCCTTTTTATTTAT
GCCAGTTGTCATGGCAGGTTTTGTAAGATATACAGCGTCC
CGCAGTCAGAGCAGAAATATAATCAGAGATCATCCTATTA
TGTTGTTGTTTTATTTTTGTTTTTCCACTAGACACCTATA
CGATCGTGTGCTGTATTGTGGCGTGTGTGTTCGCCTCCTT
GAAGACCCACAATCCCTTCCCTTACCAGTCCTCCTGTTGC
TGATCATAAAACCGAGACCTGCCGGTTCATGCTTGTTGCT
TGTAAAGATGCTGATATGTCAAAATGATGACTTCCAAATG
CTTTCTGTTTGCTTGTTTGTGTTTGTTTGGATCGAAACTT
TCATGAAGGGAACAATTATGTTGTCAAGCATTTGTACTCG
AGGTACCAGTTCAAAGAAGTGGATTATCTCTGAAACGGCT
GGCTATGATTTGATTTTGTTCATCATGATGTTCAATATAA
GACTCCTAGGAAGATGCTAAAAGTTCAAACTGTTTTGATT
GGTTCAAAAATCAGGTTAACGCAAACTAGTAGAAATTAAG
CTCAATGTTAAGTCCGTTATGGAAGGGAAACTGAGTGGAG
CTGGAGAGGAGAATTTTCTTTGTTTTGTTTTATTTCTTTT
TTAAAGATGTAATTTTTTTGTACAGAAGAATTGCTCTGAA
AAAAGTTCATTTAGTGGAATTTATGTTTGTTCTTAGAAAT
AAATCAAACTATTTATTAAAGCATTTTATAACAATGTG

jag2b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA jag2b-003 (1) 812
mRNA jag2b-201 5438
jag2b-202 (1) 5324
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jag2b-201 Contained in:
[BAC] DKEY-5P1 (1) (order this)
OTHER jag2b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000005844 (1)
  • Ensembl_Trans:ENSDART00000024922 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF229449 (1) 5469bp
    GenBank:AF090432 (1) 5138bp
    GenBank:BE605324 (1) 524bp
    CITATIONS (2)