Transcript

spint2-202

ID
ZDB-TSCRIPT-121213-148
Name
spint2-202
Previous Names
  • spint2-002
  • ch211-51k14.2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057274 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057274|OTTDARG00000028069|ZDB-GENE-061013-323 spint2|OTTDARP00000044890 CH211-51K14.2-002 LG_ AL928724.10 Danio rerio protein_coding KNOWN, 836 bp
ACGAAAACAGCTGCTGGGACAGGTAAAAAGGAAAACAAAG
AATGGCTCAGGTGTGGTTTACAACATCAATCGTCGGTTTT
CTATGCTGTTTGTCGGTTCTGAGCGCGTGTATCTGGGACC
CAGACACGGAAATCAACCAGGGTCTGGATCCGAAGTCTTT
TAATGACAACGCGCCTTACCTGACCCACCTGTCGGAGATC
ATGAACGTCGAGCAGTGCCAGCGGGCTTGCTGTGAGAGGG
AAGACTGCCAGCTTGCCTTAATCGGAAAAACAGCTGACGG
CCCGCAAGAATGTAACCTTGTTAACTGTATGAAGGACGGC
AAAGACGTGTGTGTTTTGAGCCAGACCACACAGTTCCAGG
TGTACCGCAAGATCGCGGAGACCACCAAAGGGCAAAAAAA
TCAGGCGGAAGTTCGGACTCTGAACACCACAGGTGCTGTT
GAGGACGCCCGTTCTGTCTCTCCGCGCAGCCGAATGTCTG
GACCTGAAATCAAGAATGATGTTGATCCCAAGGCTCTTAC
TGAAATGACATCAGAGGAATTCCAAGAGAAGTGTCAGTCT
CCTGCAGTGACTGGAAATTGCAGAGCCTCCATTAAGCGCT
TTTACTACAACAATGGAGTCTGTCAACAGTTCATCTATGG
AGGCTGCGGTGGCAACAAGAACAATTATGAATCTGAGGAT
TCATGCATGACAGCCTGCACAGTGAAGATCATTCCCAAAG
AACAGGAGGGCCCTGTCATTCCAGCTATTCCAAAAAGTGC
CCACAGCTTTGAAGAGAAATGTGTTGTGCCATCTGACTCG
GGGCCGTGCCGTGCATCCTTTCGTATGTTTTTCTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations