Community Action Needed: Please respond to the NIH RFI
Transcript

spint2-201

ID
ZDB-TSCRIPT-090929-18437
Name
spint2-201
Previous Names
  • spint2-001
  • zgc:153795-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038043 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038043|OTTDARG00000028069|ZDB-GENE-061013-323 spint2|OTTDARP00000030491 CH211-51K14.2-001 LG_ AL928724.10 Danio rerio protein_coding KNOWN, 2024 bp
ATCCGGGTTCGTTGTAACAGGTGTGGTCATTATAGAGTTC
GTTCAACTTCATTTTGCAGTCGCAAACAGTCGGTCATACA
CGAAAACAGCTGCTGGGACAGGTAAAAAGGAAAACAAAGA
ATGGCTCAGGTGTGGTTTACAACATCAATCGTCGGTTTTC
TATGCTGTTTGTCGGTTCTGAGCGCGTGTATCTGGGACCC
AGACACGGAAATCAACCAGGGTCTGGATCCGAAGTCTTTT
AATGACAACGCGCCTTACCTGACCCACCTGTCGGAGATCA
TGAACGTCGAGCAGTGCCAGCGGGCTTGCTGTGAGAGGGA
AGACTGCCAGCTTGCCTTAATCGGAAAAACAGCTGACGGC
CCGCAAGAATGTAACCTTGTTAACTGTATGAAGGACGGCA
AAGACGTGTGTGTTTTGAGCCAGACCACACAGTTCCAGGT
GTACCGCAAGATCGCGGAGACCACCAAAGGGCAAAAAAAT
CAGGCGGAAGTTCGGACTCTGAACACCACAGATCACTGTC
GTTTCCCAAGTGCGGTTGGGAATTGTCGTGCTGCCTTCCC
AAGGTTTTTCTACGATATCACTGATCAGACCTGCAAGTCT
TTCATCTATGGTGGCTGTGGGGGAAACGAAAATAACTTTT
ACTCCCAGGCGGAATGTGAGGCGTCCTGTCTTGGGGTGAA
GGGTGCTGTTGAGGACGCCCGTTCTGTCTCTCCGCGCAGC
CGAATGTCTGGACCTGAAATCAAGAATGATGTTGATCCCA
AGGCTCTTACTGAAATGACATCAGAGGAATTCCAAGAGAA
GTGTCAGTCTCCTGCAGTGACTGGAAATTGCAGAGCCTCC
ATTAAGCGCTTTTACTACAACAATGGAGTCTGTCAACAGT
TCATCTATGGAGGCTGCGGTGGCAACAAGAACAATTATGA
ATCTGAGGATTCATGCATGACAGCCTGCACAGTGAAGATC
ATTCCCAAAGAACAGGAGGGCCCTGTCATTCCAGCTATTC
CAAAAAGTGCCCACAGCTTTGAAGAGAAATGTGTTGTGCC
ATCTGACTCGGGGCCGTGCCGTGCATCCTTTCGTATGTTT
TTCTTCGAGGCCAGCAGTCAGTCCTGTCAGCCTTTCATCT
ATGGAGGCTGTAGGGGAAACCTGAACCGCTATGGCAGTGA
AGAAGAGTGCATGTCTGTTTGCTCCACCAAAGACGGTCGT
TTTGATGAACATGGACATGAGAAACATAGGCGCTGGACTC
CGGCATTCTTCCTAGTTGCCACACTGGCCATCATGTCTGC
CCTACTGCTAGTGGGTCTGATCCTGATCGTAGTGCGCAGA
AACTCCCACCCACACTTCAGGATTCTGGATGATAAGGAGG
AGTTGCTGCCAGCAGAGGAGCCTGTGTCTTATGAGAAACT
ACCCAAAGAAATCTAAAACCTTTCACGGTCGGGTTCAAAA
CACTCCAAGTTTCAGCTCACTTTAAATTAGCAACAGTTTA
AGTTCAATTGGAGTACATTTTCCCACAAATATGCTCCAAA
TGAGTAATATTTACTTTAAAAAGTGTGCGTAACTGAGATG
CTGTTTCACTGTTGCTCAGATTTGTATACTGTTTTAATTC
TGCACTAACGTTTGAGTTGGCTGTTACCTTGTTTGTCACT
TTTTTAGGGTTATTATATCAACAGTAATTTCACTTTCAGG
GATCTATTTATTATCACAGCCTCGAGCAAAGAGAATTAAA
CTAATAAAGGGATTTTCCTTGACTTTTGTATATGTAAACA
TTTAAATTTTACAACTGATAGAGGAGTTGATTATCTATAG
GCTTGTGACACATTTTTAATGATCTCTAGTTTAAAAGTTC
AGTAATTAAAATATTTTATAGGCTTTAATTGTAAGCATAC
ATGACAGTTCCATAAATAAAAGTGTGTAATATAAACTGTG
ACCTGTAATAGCTTCTTACCGCTGTACTTTATTTCTTTAT
TTCTGTTTTTAAATATTGTAATTTTCAATCTTGAACAATA
AACTTTTTTCTTTTTTAAGTTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations