Transcript

pnrc2-203

ID
ZDB-TSCRIPT-120702-42
Name
pnrc2-203
Previous Names
  • pnrc2-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000055328 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055328|OTTDARG00000027755|ZDB-GENE-030131-5475 pnrc2|OTTDARP00000043399 pnrc2-003 LG_ AL844887.10 Danio rerio protein_coding KNOWN, 183 bp
ATGTTCAACTCGGTTCCACGACAAAACAACGCTCACTGGC
ACATGAAAACCTCAGATCTTGCTGGACATACATGTGCAGC
GAGAAGTAGATCAACTACTTCGAGGACCTGGAGCCCAATT
GGCGAGGAAAAATTAAAAAGTGAAAAGAACCACGCACTCA
ACTTTTTTACAACAGAGAGGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations