ZFIN ID: ZDB-TSCRIPT-090929-17899
Transcript Name: pnrc2-202
Previous Name: pnrc2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037488 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037488|OTTDARG00000027755|ZDB-GENE-030131-5475 pnrc2|OTTDARP00000030044 pnrc2-001 LG_ AL844887.10 Danio rerio protein_coding KNOWN, 3146 bp
GTTGAGGGTCCATTTTGTTGTTAGACGGAGACGAACTGGA
GAAGGAGAACATCATCATTCCGCTGTAGCCTCGGTTTTTT
ACTGAGCTTCACATATCGGGAAATATTTTCTCCATTTACA
GCTACAGCTGACAGACGAGACCAAGGGAATACGAAGGGCT
TGTTCCATCAAATTCCTGAGGAAGTCGATCTACGGCTTCT
AGAGCACCGTGCGCCGAGGTGAATTCATGTTCAACTCGGT
TCCACGACAAAACAACGCTCACTGGCACATGAAAACCTCA
GATCTTGCTGGACATACATGTGCAGCGAGAAGTAGATCAA
CTACTTCGAGGACCTGGAGCCCAATTGGCGAGGAAAAATT
AAAAAGTGAAAAGAACCACGCACTCAACTTTTTTACAACA
GAGAGGTGACATCCAGTCAAAATATAATGGGAGGTGGTGA
GAGATACAACATTCCAGATCGCCCAGCACCCAAGAAGAGC
CAGCCGGTTAGCAGGGGCAAACAGAGAAGTAGAGACCAGA
ATGGAGTGATGCATTCTGCCGCCTCAGGAGCCTTAGGGGT
GCCCCATCACCTTCGCAGAGGTGAGAAGGGCACCAGCTAT
TCTTGGTCTCCTGAGGCGCGGCAGGCCGTGTCTGTAGACA
AGAAGAATGGCTCTGTTCGTTTTGCCACACCGTACGATCA
GAATTGGGAGTCCCATCTGAACAAACTTTTATCAGCTCAG
TGTGGTCAGAACTATGCCGGAGCCAAGTTTAGTGAGCCCC
CATCCCCAAGTGTGCTGCCCAAGCCCCCAAGCCACTGGGT
GTCTCTTCCCATGGGCGATCATCGTGAGTTGATGACCTTT
CAGTTAAAGAGCCTCCTGAAGGTTCAGGCCTAACAAGGTC
TCTCACTGCTGCTCTCTTAAGCCAATACATGATAAAGGCT
TCACTTTGGCCTTTTGCCTTCTCCTTGAACGCCCCAGCTG
CGTAATATATTTTACAGCTATTTTTAGATCTGCATCTTAA
TAAGATGGTGATGATCATTTGGTAGACAGATGTTCCTCCT
AATGTCCGTCATCTAACATATTTTTTTAAACAAAGAAACT
AGTTATTACGCTGTTGTGGTCTTAAGAAGCGGTCAAGAAG
TCTTTGGGGAGCTGTATGCCATGACAAATGATGAACTGGA
TGTCCTCTTAAACTCATTGCTCTGTTATGCTCCTGTTTTG
TTTTGTTCTTTTTTTGATGGCTGTTTGTGACAGTCAGATT
TTTTTTCTTCTTCCGCTAGACCTAGAAATAGATGTCAAGA
CAAACTCGCGCATCGTTTTTACTTTCCAATATATCTCGCA
TTTTGTTTTTCTTGCTTGCTGAGGTTTGATGCTCACTTTT
GGCTTGAGTTTTAATCAAGCTGGGAGTGCCAGAAACTTCT
TGGTGCTAAGCACAGCAGCATCTGTAGCGTAATAGTGCGT
ACTGCATTTCCGGGTATCTCTTTTTGTTTTGCTTTTTGGG
AAGTAAAAGCCACTCGACTTTGTTCTGCAGGGAGACCTAA
GCGAACAGAACATGAAGGGGTACAAGCTTAAGTGAAAAGG
TCATATGACTAACCTCAAGCTTAATGAGGTGGCACAATGA
ACCTTGTGCTTTCAACACCTGTACTTTTTTAATGGCGCTG
TGCGCATTGCACTATAGGTGTTGAATTCACTATGGTTCTC
AAGCTCTATTGCAGCGTTAAACTTTTACTTTTTGCATCCC
TTGTGTTATAGCTTAGAAAACTAAGTGTGATTTTTAATGT
TTACCAAAGCGACGTAATCAGCTACTTTTTGTTGAAAGCC
CCCACCTTGCTTGACCAGATCTGGTTACAAGTGCCATAAA
TCATTGCGTAAGGCATTAGCGTATATCAAGGTTTTGGGTG
ACGAATCATTTTTTAAAAAATTTCGCTGTACTTTTGGAAT
GATCACAGAGCAATTATGCGGAGGAGGGTTATGACGTGAG
ACCGTAGGATGTAAGTTTTCTCTAATCTCGTCTCATAGCC
TTGTTTGCTCTGTGATGCATTTTAAATTCCTAAGCATTAA
GTTATGAAATGTGTGTATTATGGCACGGGGGAACTGAGAA
ATCGGGCGCAGGTCCAGTGTGGACATGTTTACATGGTTTG
TTTTTTAAAGAAGGCAGACTGCCGGCATTTTACACACATA
CACTGCCCTTTCTCACTTGTTGTTATTCTTGCACTGATGT
TCATTTGTGTTCAAACGTTTCAGACAATGTTGCTCTTTCG
ACTGTGGATATGTGATGAAGCACCCCTTCCCACTTAGTTA
TGAGTGTGGTGGAAAACTACCTCTCTTGCAGAACGTGATG
TTAATAGCTATCTTAAAGACGACAAAACAAAGCTGATGTG
TGTAATGGAGCCATGTAAATAATGAAATGTATAAAATGTT
GTAGCATATTGTACATTTGTGCAGGAACATTTGAAACCTG
CGGATAAAGTATTTTTTAGTAATAACACTGAATGTAAAGT
CACGCTATGGACGTGGCTTGTTTTCAAATGCTGAAGAAAA
AATATTTTGTTAAGAAAAAAAAAGAAAATGTTGCCTATAG
TGCGTCAGAACCCCTGCACTGTGCGGTTTGTTGCCAGTGA
TCTTGCACATGATTTTTATTTTGTATAATGCACCGTGTAG
GGCAGAACGAGCTTTAAGTGCAAGTCAAAAAAAAAAAAAA
GAAAAAAAGATTTGAAAATTGAAAGGGACTTTTATACATT
TTTTTTAAGTTGTCTATGCAAATAGAAAAAATATTTTTAT
TTATTTTTTGTTCTGTTATAACAGTTCTTATTTTGCCCTT
TATACAGAGTCCATAAAGCAGTGTTGCATTTGCATTGATT
CATTGGTCTTTCCTCCGCAGGCCAATGTTTAAAGCAAATG
AATGCTGCGTGTTACCTCTGGTAATAACAGATTACATTTT
TAGCCTTTTTTTTTTAAAGTGAAACAAAATAATATATGTG
TATTTTTAACGAAATGTGTAAAAGTCCTTTTCCTAAATTT
GTCCTAAACAATTGGCTTTGAATTTATCCCAACCATGAAA
ATGTCACTTGAAAAGAAAACTAAGAGCCCTGAAACAATTG
GTACGTACTAAAAGATTGTGTTATTTGGTTATCTAAAAAG
AAATAAAATTCCTTCCCTTCCCCCCA

pnrc2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pnrc2-202 3146
pnrc2-203 (1)    Ensembl 183
ncRNA pnrc2-002 (1)    Ensembl 676
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pnrc2-202 Contained in:
[BAC] DKEY-66C10 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000037488 (1),  Ensembl_Trans:ENSDART00000145055 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC139660 (1) 2529 nt
GenBank:BC108024 (1) 2337 nt
GenBank:BC124276 (1) 2268 nt
GenBank:CO914872 (1) 803 nt
GenBank:EB989277 (1) 621 nt
GenBank:AW153731 (1) 551 nt
CITATIONS (2)