Transcript

grhl3-004

ID
ZDB-TSCRIPT-120702-176
Name
grhl3-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055543 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055543|OTTDARG00000030448|ZDB-GENE-030131-9854 grhl3|no_translation grhl3-004 LG_ AL928908.16 Danio rerio protein_coding KNOWN, 527 bp
GTTTGTTATTGTCCAGGTACCCCCTGTTAGCCTGGAGGAA
AGTGACAGGTCATCGCTGAAACGTTACGCAGACGCCAATG
AGCAGAGCAGCTCCCCGCCATGCAAACAACCCCGCAGAGA
CGAGCAGAGAGTCCTCCTGTACGTCAGACGAGAATCTGAG
GAAGTATTTGATGCCCTCATGCTGAACACGCCAAACCTCA
AGGGCCTTAAAGAAGCGATTTCAGAAAAGTATGGCATGCA
AGAAGACACCATTGGGAAAATTTTCAAGAAGTGCAAAAGA
GGGTGAGTGTGTTATTTTTAAGCCGAACTCCGTTGGGCGG
AAACATTTGGGGACAGTTAGACGATGTGATGAAGTCACGA
ACAGCAGATAGAGGGATGTCGAAACGCTGAGACGTTAAAC
CTTTTTCTTACAATCTGAGCTCCATCTCGACAAGCTGCCA
GGAAGCAAAGTCGACAGACCGGGTTGACAGGAGATCTATA
GAGTTTGGAATGTGATGATTGCTGCTCCCCTTCAAAAAAA
AAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations