Transcript

grhl3-203

ID
ZDB-TSCRIPT-090929-21909
Name
grhl3-203
Previous Names
  • grhl3-003
  • si:dkey-221l4.7-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042170 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042170|OTTDARG00000030448|ZDB-GENE-030131-9854 grhl3|OTTDARP00000033571 grhl3-003 LG_ AL928908.16 Danio rerio protein_coding KNOWN, 776 bp
ACACACATATTTAACCACAAGCACACCTCAGAGAGGAGAC
CGGATACCAAACTAAGGATTTTATCAGCACTGCCTGTACA
AGGAGTCATGACCAAGGAGATTGAGGCTCTCATGGTACAA
CAGAACGAGAGTTTCAGCCACATACGCACATACGAAAGTT
ACGTTATGGACTACTGGACCAACATGGACAGCGGTAACCT
CAGTAAAACTAAACCCAGACTGGCTTCAGATGAAGATCTG
GCTACTCTAAACCTTCTCTATGATGCCTGCAAGCCTTCAA
AAGAGCAGAAGATGACATCATGTGCCCGTGAGAGCAGCAT
TTACAAATCAATGGAGAGGACGGCAAACAGCTCTTCCCCT
GAACTTGCCCCGCTGGAGAACGCTCACATCATGAAGTTCC
TTTCAGAAAACATGTCCTTCAACCCCTCAAAGCCTAGCAC
TGACAGCTACACAACAGACAACTATGATAAGCAAGTCAAC
CTGAACAACATCTTCGACTCTCTCCTGCCTCAACCGTCGC
AGAAATCATGGCAATCGGATCAAACCTTTCTGGAGGCCAC
ACCTGAGGTCCGCATTTATCATATTGGCCACAATGGATTT
GGGGGACAGACAAGCCCTGTTTACTCAGATTCCTACTCTT
CTCCAGGAAGATACAGGAATGATTTCCAATTCCTTCTCGG
TGCCCCACAAGCTTCCCAGCACAAGACGACAGAAATCCCC
ATGGTTTACCTCAACAAGGGCCAGTTTTACCCAATTACAC
TGCAGGGGGTCGACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations