ZFIN ID: ZDB-TSCRIPT-090929-21909
Transcript Name: grhl3-203
Previous Names: grhl3-003, si:dkey-221l4.7-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042170 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042170|OTTDARG00000030448|ZDB-GENE-030131-9854 grhl3|OTTDARP00000033571 grhl3-003 LG_ AL928908.16 Danio rerio protein_coding KNOWN, 776 bp
ACACACATATTTAACCACAAGCACACCTCAGAGAGGAGAC
CGGATACCAAACTAAGGATTTTATCAGCACTGCCTGTACA
AGGAGTCATGACCAAGGAGATTGAGGCTCTCATGGTACAA
CAGAACGAGAGTTTCAGCCACATACGCACATACGAAAGTT
ACGTTATGGACTACTGGACCAACATGGACAGCGGTAACCT
CAGTAAAACTAAACCCAGACTGGCTTCAGATGAAGATCTG
GCTACTCTAAACCTTCTCTATGATGCCTGCAAGCCTTCAA
AAGAGCAGAAGATGACATCATGTGCCCGTGAGAGCAGCAT
TTACAAATCAATGGAGAGGACGGCAAACAGCTCTTCCCCT
GAACTTGCCCCGCTGGAGAACGCTCACATCATGAAGTTCC
TTTCAGAAAACATGTCCTTCAACCCCTCAAAGCCTAGCAC
TGACAGCTACACAACAGACAACTATGATAAGCAAGTCAAC
CTGAACAACATCTTCGACTCTCTCCTGCCTCAACCGTCGC
AGAAATCATGGCAATCGGATCAAACCTTTCTGGAGGCCAC
ACCTGAGGTCCGCATTTATCATATTGGCCACAATGGATTT
GGGGGACAGACAAGCCCTGTTTACTCAGATTCCTACTCTT
CTCCAGGAAGATACAGGAATGATTTCCAATTCCTTCTCGG
TGCCCCACAAGCTTCCCAGCACAAGACGACAGAAATCCCC
ATGGTTTACCTCAACAAGGGCCAGTTTTACCCAATTACAC
TGCAGGGGGTCGACAG

grhl3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA grhl3-201 (1)    Ensembl 2659
grhl3-203 776
ncRNA grhl3-002 (1)    Ensembl 793
grhl3-004 (1)    Ensembl 527
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grhl3-203 Contained in:
[BAC] DKEY-221L4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000042170 (1),  Ensembl_Trans:ENSDART00000147192 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CV482395 (1) 777 nt
GenBank:CV483515 (1) 753 nt
CITATIONS (2)